EMAIL THIS PAGE TO A FRIEND

GAGE2D

G antigen 2D

12 Gene Product Result for
Synonyms: CT4.8 GAGE-2D GAGE-8 GAGE8
Species: Human GAGE2D(729408)
UniProtKB ID: Q9UEU5, A6NG46, A6NNR8, B7ZL76, Q4V325
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098407 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318835 predicted 193
2 SASI_Hs02_00318836 predicted 239
3 SASI_Hs02_00318837 predicted 246
4 SASI_Hs02_00318838 predicted 217
5 SASI_Hs02_00318839 predicted 251
6 SASI_Hs02_00318840 predicted 216
7 SASI_Hs02_00318841 predicted 154
8 SASI_Hs02_00318842 predicted 157
9 SASI_Hs02_00318843 predicted 397
10 SASI_Hs02_00318844 predicted 155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098407
GAGE2D MISSION shRNA Bacterial Glycerol Stock
G antigen 2D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-224s21c1
Sequence:CCGGACCAGCAACACCTGAAGAAGGCTCGAGCCTTCTTCAGGTGTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-147s21c1
Sequence:CCGGCCTAGACCAAGACGCTACGTACTCGAGTACGTAGCGTCTTGGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-343s21c1
Sequence:CCGGAGGAACAGGGTCACCCACAGACTCGAGTCTGTGGGTGACCCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-305s21c1
Sequence:CCGGATCTGCAGGTCAAGGGCCGAACTCGAGTTCGGCCCTTGACCTGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-252s21c1
Sequence:CCGGGCAACTCAACGTCAGGATCCTCTCGAGAGGATCCTGACGTTGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-363s21c1
Sequence:CCGGACTGGGTGTGAGTGTGAAGATCTCGAGATCTTCACACTCACACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-205s21c1
Sequence:CCGGAGTTCAGTGATGAAGTGGAACCTCGAGGTTCCACTTCATCACTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-162s21c1
Sequence:CCGGTACGTAGAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTCTACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-329s21c1
Sequence:CCGGTGAAGCTGATAGCCAGGAACACTCGAGTGTTCCTGGCTATCAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098407
GAGE2D MISSION shRNA shRNA Plasmid DNA
G antigen 2D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-224s21c1
Sequence:CCGGACCAGCAACACCTGAAGAAGGCTCGAGCCTTCTTCAGGTGTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-147s21c1
Sequence:CCGGCCTAGACCAAGACGCTACGTACTCGAGTACGTAGCGTCTTGGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-343s21c1
Sequence:CCGGAGGAACAGGGTCACCCACAGACTCGAGTCTGTGGGTGACCCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-305s21c1
Sequence:CCGGATCTGCAGGTCAAGGGCCGAACTCGAGTTCGGCCCTTGACCTGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-252s21c1
Sequence:CCGGGCAACTCAACGTCAGGATCCTCTCGAGAGGATCCTGACGTTGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-363s21c1
Sequence:CCGGACTGGGTGTGAGTGTGAAGATCTCGAGATCTTCACACTCACACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-205s21c1
Sequence:CCGGAGTTCAGTGATGAAGTGGAACCTCGAGGTTCCACTTCATCACTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-162s21c1
Sequence:CCGGTACGTAGAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTCTACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-329s21c1
Sequence:CCGGTGAAGCTGATAGCCAGGAACACTCGAGTGTTCCTGGCTATCAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098407
GAGE2D MISSION shRNA Lentiviral Transduction Particles
G antigen 2D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-224s21c1
Sequence:CCGGACCAGCAACACCTGAAGAAGGCTCGAGCCTTCTTCAGGTGTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-147s21c1
Sequence:CCGGCCTAGACCAAGACGCTACGTACTCGAGTACGTAGCGTCTTGGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-343s21c1
Sequence:CCGGAGGAACAGGGTCACCCACAGACTCGAGTCTGTGGGTGACCCTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-305s21c1
Sequence:CCGGATCTGCAGGTCAAGGGCCGAACTCGAGTTCGGCCCTTGACCTGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-252s21c1
Sequence:CCGGGCAACTCAACGTCAGGATCCTCTCGAGAGGATCCTGACGTTGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-363s21c1
Sequence:CCGGACTGGGTGTGAGTGTGAAGATCTCGAGATCTTCACACTCACACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-205s21c1
Sequence:CCGGAGTTCAGTGATGAAGTGGAACCTCGAGGTTCCACTTCATCACTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-162s21c1
Sequence:CCGGTACGTAGAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTCTACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098407.1-329s21c1
Sequence:CCGGTGAAGCTGATAGCCAGGAACACTCGAGTGTTCCTGGCTATCAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)