EMAIL THIS PAGE TO A FRIEND

GAGE2E

G antigen 2E

8 Gene Product Result for
Synonyms: GAGE-2E GAGE8
Species: Human GAGE2E(26749)
UniProtKB ID: Q4V326, A6NFB1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127200 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224181 MISSION® esiRNA esiRNA targeting human GAGE2E human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127200 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328727 predicted 112
2 SASI_Hs02_00328728 predicted 111
3 SASI_Hs02_00328729 predicted 108
4 SASI_Hs02_00328730 predicted 93
5 SASI_Hs02_00328731 predicted 87
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127200
GAGE2E MISSION shRNA Bacterial Glycerol Stock
G antigen 2E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-284s21c1
Sequence:CCGGCTGAAGCTGATAGCCAGGAACCTCGAGGTTCCTGGCTATCAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-131s21c1
Sequence:CCGGCTGAAATGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-329s21c1
Sequence:CCGGAGTGTGAAGATGGTCCTGATGCTCGAGCATCAGGACCATCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-104s21c1
Sequence:CCGGCTAGACCAAGACGCTACGTAGCTCGAGCTACGTAGCGTCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-117s21c1
Sequence:CCGGCTACGTAGAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127200
GAGE2E MISSION shRNA shRNA Plasmid DNA
G antigen 2E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-284s21c1
Sequence:CCGGCTGAAGCTGATAGCCAGGAACCTCGAGGTTCCTGGCTATCAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-131s21c1
Sequence:CCGGCTGAAATGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-329s21c1
Sequence:CCGGAGTGTGAAGATGGTCCTGATGCTCGAGCATCAGGACCATCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-104s21c1
Sequence:CCGGCTAGACCAAGACGCTACGTAGCTCGAGCTACGTAGCGTCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-117s21c1
Sequence:CCGGCTACGTAGAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127200
GAGE2E MISSION shRNA Lentiviral Transduction Particles
G antigen 2E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-284s21c1
Sequence:CCGGCTGAAGCTGATAGCCAGGAACCTCGAGGTTCCTGGCTATCAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-131s21c1
Sequence:CCGGCTGAAATGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-329s21c1
Sequence:CCGGAGTGTGAAGATGGTCCTGATGCTCGAGCATCAGGACCATCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-104s21c1
Sequence:CCGGCTAGACCAAGACGCTACGTAGCTCGAGCTACGTAGCGTCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127200.1-117s21c1
Sequence:CCGGCTACGTAGAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTCTACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks