EMAIL THIS PAGE TO A FRIEND

GAGE4

G antigen 4

26 Gene Product Result for
Synonyms: CT4.4
Species: Human GAGE4(2576)
UniProtKB ID: Q13068, A8MU85, Q6NT33
Gene ID:
Human(2576) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331933 predicted 216
2 SASI_Hs02_00331934 predicted 214
3 SASI_Hs02_00331935 predicted 217
4 SASI_Hs01_00239383 predicted 119
5 SASI_Hs01_00239385 predicted 358
6 SASI_Hs02_00331936 predicted 169
7 SASI_Hs01_00239388 predicted 127
8 SASI_Hs02_00331937 predicted 333
9 SASI_Hs02_00331938 predicted 149
10 SASI_Hs02_00331939 predicted 326
11 SASI_Hs01_00239384 predicted 105
12 SASI_Hs01_00239386 predicted 99
13 SASI_Hs01_00239387 predicted 102
14 SASI_Hs01_00239389 predicted 130
15 SASI_Hs01_00239390 predicted 368
16 SASI_Hs01_00239391 predicted 117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001474
GAGE4 MISSION shRNA Bacterial Glycerol Stock
G antigen 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-130s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-217s21c1
Sequence:CCGGACCAGCAACTCAACGTCAGGACTCGAGTCCTGACGTTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-329s21c1
Sequence:CCGGCAGACTGGGTGTGAGTGTGAACTCGAGTTCACACTCACACCCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-190s21c1
Sequence:CCGGGGAACCAGCAACACCTGAAGACTCGAGTCTTCAGGTGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-168s21c1
Sequence:CCGGCCGAGCAGTTCAGTGATGAAGCTCGAGCTTCATCACTGAACTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-113s21c1
Sequence:CCGGTGGCCTAGACCAAGGCGCTATCTCGAGATAGCGCCTTGGTCTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-288s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTGATACTCGAGTATCAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-146s21c1
Sequence:CCGGGAAATGATTGGGCCTATGCGGCTCGAGCCGCATAGGCCCAATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-134s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-143s1c2
Sequence:CCGGCCTGAAATGATTGGGCCTATGCTCGAGCATAGGCCCAATCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001474
GAGE4 MISSION shRNA shRNA Plasmid DNA
G antigen 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-130s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-217s21c1
Sequence:CCGGACCAGCAACTCAACGTCAGGACTCGAGTCCTGACGTTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-329s21c1
Sequence:CCGGCAGACTGGGTGTGAGTGTGAACTCGAGTTCACACTCACACCCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-190s21c1
Sequence:CCGGGGAACCAGCAACACCTGAAGACTCGAGTCTTCAGGTGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-168s21c1
Sequence:CCGGCCGAGCAGTTCAGTGATGAAGCTCGAGCTTCATCACTGAACTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-113s21c1
Sequence:CCGGTGGCCTAGACCAAGGCGCTATCTCGAGATAGCGCCTTGGTCTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-288s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTGATACTCGAGTATCAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-146s21c1
Sequence:CCGGGAAATGATTGGGCCTATGCGGCTCGAGCCGCATAGGCCCAATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-134s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-143s1c2
Sequence:CCGGCCTGAAATGATTGGGCCTATGCTCGAGCATAGGCCCAATCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001474
GAGE4 MISSION shRNA Lentiviral Transduction Particles
G antigen 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-130s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAATCTCGAGATTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-217s21c1
Sequence:CCGGACCAGCAACTCAACGTCAGGACTCGAGTCCTGACGTTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-329s21c1
Sequence:CCGGCAGACTGGGTGTGAGTGTGAACTCGAGTTCACACTCACACCCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-190s21c1
Sequence:CCGGGGAACCAGCAACACCTGAAGACTCGAGTCTTCAGGTGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-168s21c1
Sequence:CCGGCCGAGCAGTTCAGTGATGAAGCTCGAGCTTCATCACTGAACTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-113s21c1
Sequence:CCGGTGGCCTAGACCAAGGCGCTATCTCGAGATAGCGCCTTGGTCTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-288s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTGATACTCGAGTATCAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001474.1-146s21c1
Sequence:CCGGGAAATGATTGGGCCTATGCGGCTCGAGCCGCATAGGCCCAATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-134s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001474.1-143s1c2
Sequence:CCGGCCTGAAATGATTGGGCCTATGCTCGAGCATAGGCCCAATCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks