EMAIL THIS PAGE TO A FRIEND

GAGE5

G antigen 5

16 Gene Product Result for
Synonyms: CT4.5
Species: Human GAGE5(2577)
UniProtKB ID: Q13069, Q6FG72
Gene ID:
Human(2577) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402779 Monoclonal Anti-GAGE5, (C-terminal) antibody produced in mouse clone 8F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001475 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331940 predicted 200
2 SASI_Hs02_00331941 predicted 210
3 SASI_Hs02_00331942 predicted 206
4 SASI_Hs01_00047962 predicted 120
5 SASI_Hs01_00047965 predicted 115
6 SASI_Hs01_00047967 predicted 110
7 SASI_Hs01_00047969 predicted 98
8 SASI_Hs01_00047961 predicted 88
9 SASI_Hs02_00331943 predicted 457
10 SASI_Hs01_00047963 predicted 351
11 SASI_Hs01_00047964 predicted 90
12 SASI_Hs01_00047966 predicted 91
13 SASI_Hs01_00047968 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001475
GAGE5 MISSION shRNA Bacterial Glycerol Stock
G antigen 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-281s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTGATAGCTCGAGCTATCAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-127s21c1
Sequence:CCGGTACAGCCTCCTGAAGTGATTGCTCGAGCAATCACTTCAGGAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-135s21c1
Sequence:CCGGCCTGAAGTGATTGGGCCTATGCTCGAGCATAGGCCCAATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-173s21c1
Sequence:CCGGTGATGAAGTGGAACCAGCAACCTCGAGGTTGCTGGTTCCACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-108s21c1
Sequence:CCGGCCTAGACCAAGGCGCTATGTACTCGAGTACATAGCGCCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001475
GAGE5 MISSION shRNA shRNA Plasmid DNA
G antigen 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-281s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTGATAGCTCGAGCTATCAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-127s21c1
Sequence:CCGGTACAGCCTCCTGAAGTGATTGCTCGAGCAATCACTTCAGGAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-135s21c1
Sequence:CCGGCCTGAAGTGATTGGGCCTATGCTCGAGCATAGGCCCAATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-173s21c1
Sequence:CCGGTGATGAAGTGGAACCAGCAACCTCGAGGTTGCTGGTTCCACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-108s21c1
Sequence:CCGGCCTAGACCAAGGCGCTATGTACTCGAGTACATAGCGCCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001475
GAGE5 MISSION shRNA Lentiviral Transduction Particles
G antigen 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-281s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTGATAGCTCGAGCTATCAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-127s21c1
Sequence:CCGGTACAGCCTCCTGAAGTGATTGCTCGAGCAATCACTTCAGGAGGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-135s21c1
Sequence:CCGGCCTGAAGTGATTGGGCCTATGCTCGAGCATAGGCCCAATCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-173s21c1
Sequence:CCGGTGATGAAGTGGAACCAGCAACCTCGAGGTTGCTGGTTCCACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001475.1-108s21c1
Sequence:CCGGCCTAGACCAAGGCGCTATGTACTCGAGTACATAGCGCCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks