EMAIL THIS PAGE TO A FRIEND

GAGE6

G antigen 6

Synonyms: CT4.6
Species: Human GAGE6(2578)
UniProtKB ID: Q13070
Gene ID:
Human(2578) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038240 predicted 122
2 SASI_Hs01_00038242 predicted 125
3 SASI_Hs01_00038244 predicted 121
4 SASI_Hs01_00038245 predicted 114
5 SASI_Hs01_00038239 predicted 98
6 SASI_Hs01_00038241 predicted 91
7 SASI_Hs01_00038243 predicted 95
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001476
GAGE6 MISSION shRNA Bacterial Glycerol Stock
G antigen 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-165s21c1
Sequence:CCGGGCCCGAGCAGTTCAGTGATGACTCGAGTCATCACTGAACTGCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-143s21c1
Sequence:CCGGCTGAAGTGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-213s21c1
Sequence:CCGGGGAACCAGCAACTCAACGTCACTCGAGTGACGTTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-116s21c1
Sequence:CCGGCTAGACCAAGGCGCTATGTACCTCGAGGTACATAGCGCCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-182s21c1
Sequence:CCGGATGAAGTGGAACCAGCAACACCTCGAGGTGTTGCTGGTTCCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-289s21c1
Sequence:CCGGCCGAAGCCTGAAGCTGATAGCCTCGAGGCTATCAGCTTCAGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-225s21c1
Sequence:CCGGTCAACGTCAGGATCCTGCAGCCTCGAGGCTGCAGGATCCTGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-129s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAGTCTCGAGACTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001476
GAGE6 MISSION shRNA shRNA Plasmid DNA
G antigen 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-165s21c1
Sequence:CCGGGCCCGAGCAGTTCAGTGATGACTCGAGTCATCACTGAACTGCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-143s21c1
Sequence:CCGGCTGAAGTGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-213s21c1
Sequence:CCGGGGAACCAGCAACTCAACGTCACTCGAGTGACGTTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-116s21c1
Sequence:CCGGCTAGACCAAGGCGCTATGTACCTCGAGGTACATAGCGCCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-182s21c1
Sequence:CCGGATGAAGTGGAACCAGCAACACCTCGAGGTGTTGCTGGTTCCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-289s21c1
Sequence:CCGGCCGAAGCCTGAAGCTGATAGCCTCGAGGCTATCAGCTTCAGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-225s21c1
Sequence:CCGGTCAACGTCAGGATCCTGCAGCCTCGAGGCTGCAGGATCCTGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-129s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAGTCTCGAGACTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001476
GAGE6 MISSION shRNA Lentiviral Transduction Particles
G antigen 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-165s21c1
Sequence:CCGGGCCCGAGCAGTTCAGTGATGACTCGAGTCATCACTGAACTGCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-143s21c1
Sequence:CCGGCTGAAGTGATTGGGCCTATGCCTCGAGGCATAGGCCCAATCACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-213s21c1
Sequence:CCGGGGAACCAGCAACTCAACGTCACTCGAGTGACGTTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-116s21c1
Sequence:CCGGCTAGACCAAGGCGCTATGTACCTCGAGGTACATAGCGCCTTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-182s21c1
Sequence:CCGGATGAAGTGGAACCAGCAACACCTCGAGGTGTTGCTGGTTCCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-289s21c1
Sequence:CCGGCCGAAGCCTGAAGCTGATAGCCTCGAGGCTATCAGCTTCAGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-225s21c1
Sequence:CCGGTCAACGTCAGGATCCTGCAGCCTCGAGGCTGCAGGATCCTGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001476.1-129s21c1
Sequence:CCGGCTATGTACAGCCTCCTGAAGTCTCGAGACTTCAGGAGGCTGTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks