EMAIL THIS PAGE TO A FRIEND

GAGE7

G antigen 7

10 Gene Product Result for
Synonyms: AL4 CT4.7 GAGE-7
Species: Human GAGE7(2579)
UniProtKB ID: O76087, B7ZM13, Q4V324
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412709 Anti-GAGE7 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021123 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160998 predicted 92
2 SASI_Hs01_00161002 predicted 94
3 SASI_Hs01_00161003 predicted 96
4 SASI_Hs01_00161004 predicted 82
5 SASI_Hs01_00160999 predicted 70
6 SASI_Hs01_00161000 predicted 61
7 SASI_Hs01_00161001 predicted 71
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021123
GAGE7 MISSION shRNA Bacterial Glycerol Stock
G antigen 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-232s21c1
Sequence:CCGGAGGATGAGGGAGCATCTGCAGCTCGAGCTGCAGATGCTCCCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-274s21c1
Sequence:CCGGCTCATAGCCAGGAACAGGGTCCTCGAGGACCCTGTTCCTGGCTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021123.1-170s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-139s1c1
Sequence:CCGGTCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-215s1c1
Sequence:CCGGCCAGCAACTCAACGTCAGGATCTCGAGATCCTGACGTTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-126s1c1
Sequence:CCGGGCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-164s1c1
Sequence:CCGGCCCGAGCAGTTCAGTGATGAACTCGAGTTCATCACTGAACTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-338s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021123
GAGE7 MISSION shRNA shRNA Plasmid DNA
G antigen 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-232s21c1
Sequence:CCGGAGGATGAGGGAGCATCTGCAGCTCGAGCTGCAGATGCTCCCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-274s21c1
Sequence:CCGGCTCATAGCCAGGAACAGGGTCCTCGAGGACCCTGTTCCTGGCTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021123.1-170s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-139s1c1
Sequence:CCGGTCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-215s1c1
Sequence:CCGGCCAGCAACTCAACGTCAGGATCTCGAGATCCTGACGTTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-126s1c1
Sequence:CCGGGCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-164s1c1
Sequence:CCGGCCCGAGCAGTTCAGTGATGAACTCGAGTTCATCACTGAACTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-338s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021123
GAGE7 MISSION shRNA Lentiviral Transduction Particles
G antigen 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-232s21c1
Sequence:CCGGAGGATGAGGGAGCATCTGCAGCTCGAGCTGCAGATGCTCCCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021123.2-274s21c1
Sequence:CCGGCTCATAGCCAGGAACAGGGTCCTCGAGGACCCTGTTCCTGGCTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021123.1-170s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-139s1c1
Sequence:CCGGTCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-215s1c1
Sequence:CCGGCCAGCAACTCAACGTCAGGATCTCGAGATCCTGACGTTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-126s1c1
Sequence:CCGGGCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-164s1c1
Sequence:CCGGCCCGAGCAGTTCAGTGATGAACTCGAGTTCATCACTGAACTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021123.1-338s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks