EMAIL THIS PAGE TO A FRIEND

GAK

cyclin G associated kinase

Synonyms: DNAJ26 DNAJC26
UniProtKB ID: O14976, Q9BVY6
Gene ID:
Human(2580) Summary: In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. [provided by RefSeq, Jul 2008]
Mouse(231580) cyclin G associated kinase
Rat(81659) cyclin G associated kinase
Zebrafish(571705) cyclin G associated kinase
chicken(427291) cyclin G associated kinase
dog(479133) cyclin G associated kinase
cow(511296) cyclin G associated kinase
Horse(100051853) cyclin G associated kinase
domestic cat(101094018) cyclin G associated kinase
sheep(101106688) cyclin G associated kinase
domestic guinea pig(100720772) cyclin G associated kinase
naked mole-rat(101699807) cyclin G associated kinase
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158381 MISSION® esiRNA esiRNA human GAK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005255 Rosetta Predictions human pricing
NM_031030 Rosetta Predictions rat pricing
NM_153569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123910 predicted 881
2 SASI_Hs01_00123911 predicted 3841
3 SASI_Hs02_00339282 predicted 390
4 SASI_Hs01_00123912 predicted 2421
5 SASI_Hs01_00123913 predicted 3631
6 SASI_Hs01_00123914 predicted 1440
7 SASI_Hs01_00123915 predicted 1043
8 SASI_Hs01_00123916 predicted 4061
9 SASI_Hs01_00123917 predicted 835
10 SASI_Hs02_00339283 predicted 398
11 SASI_Hs01_00123918 predicted 652
12 SASI_Hs01_00123919 predicted 3234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083732 predicted 3636
2 SASI_Rn01_00083733 predicted 294
3 SASI_Rn01_00083734 predicted 1042
4 SASI_Rn01_00083735 predicted 986
5 SASI_Rn01_00083736 predicted 972
6 SASI_Rn01_00083738 predicted 1734
7 SASI_Rn01_00083739 predicted 1393
8 SASI_Rn02_00264232 predicted 3933
9 SASI_Rn02_00264233 predicted 3717
10 SASI_Rn01_00083741 predicted 1819
11 SASI_Rn01_00083737 predicted 313
12 SASI_Rn01_00083740 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045314 predicted 3632
2 SASI_Mm01_00045315 predicted 3315
3 SASI_Mm01_00045316 predicted 3506
4 SASI_Mm01_00045317 predicted 2180
5 SASI_Mm01_00045318 predicted 2050
6 SASI_Mm01_00045319 predicted 1394
7 SASI_Mm01_00045320 predicted 1386
8 SASI_Mm01_00045321 predicted 603
9 SASI_Mm02_00343373 predicted 765
10 SASI_Mm01_00045322 predicted 1723
11 SASI_Mm01_00045323 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005255
VALIDATED
GAK MISSION shRNA Bacterial Glycerol Stock
cyclin G associated kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-3438s1c1
Sequence:CCGGGCCTAACTATGCCTCGAACTTCTCGAGAAGTTCGAGGCATAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-1870s1c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-4100s1c1
Sequence:CCGGAGCATTCCAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTGGAATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-1244s1c1
Sequence:CCGGCCAGAATTGCAGTGATGTCATCTCGAGATGACATCACTGCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-2091s1c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005255.1-4141s1c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-4112s1c1
Sequence:CCGGCCTCTGATTGTTGTTTCCTTTCTCGAGAAAGGAAACAACAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.1-3541s1c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-529s1c1
Sequence:CCGGGAGAACTTGTTGCTTAGTAACCTCGAGGTTACTAAGCAACAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-685s1c1
Sequence:CCGGCCAGAAATCATAGACTTGTATCTCGAGATACAAGTCTATGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005255.2-4340s21c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005255.1-1196s1c1
Sequence:CCGGCCGTCGCTAATTATGCAAAGGCTCGAGCCTTTGCATAATTAGCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2069s21c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2290s21c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-3740s21c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005255
VALIDATED
GAK MISSION shRNA shRNA Plasmid DNA
cyclin G associated kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-3438s1c1
Sequence:CCGGGCCTAACTATGCCTCGAACTTCTCGAGAAGTTCGAGGCATAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-1870s1c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-4100s1c1
Sequence:CCGGAGCATTCCAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTGGAATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-1244s1c1
Sequence:CCGGCCAGAATTGCAGTGATGTCATCTCGAGATGACATCACTGCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-2091s1c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005255.1-4141s1c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-4112s1c1
Sequence:CCGGCCTCTGATTGTTGTTTCCTTTCTCGAGAAAGGAAACAACAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.1-3541s1c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-529s1c1
Sequence:CCGGGAGAACTTGTTGCTTAGTAACCTCGAGGTTACTAAGCAACAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-685s1c1
Sequence:CCGGCCAGAAATCATAGACTTGTATCTCGAGATACAAGTCTATGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005255.2-4340s21c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005255.1-1196s1c1
Sequence:CCGGCCGTCGCTAATTATGCAAAGGCTCGAGCCTTTGCATAATTAGCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2069s21c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2290s21c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-3740s21c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005255
VALIDATED
GAK MISSION shRNA Lentiviral Transduction Particles
cyclin G associated kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-3438s1c1
Sequence:CCGGGCCTAACTATGCCTCGAACTTCTCGAGAAGTTCGAGGCATAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-1870s1c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-4100s1c1
Sequence:CCGGAGCATTCCAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTGGAATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.x-1244s1c1
Sequence:CCGGCCAGAATTGCAGTGATGTCATCTCGAGATGACATCACTGCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.x-2091s1c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005255.1-4141s1c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-4112s1c1
Sequence:CCGGCCTCTGATTGTTGTTTCCTTTCTCGAGAAAGGAAACAACAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005255.1-3541s1c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-529s1c1
Sequence:CCGGGAGAACTTGTTGCTTAGTAACCTCGAGGTTACTAAGCAACAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005255.1-685s1c1
Sequence:CCGGCCAGAAATCATAGACTTGTATCTCGAGATACAAGTCTATGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005255.2-4340s21c1
Sequence:CCGGCCGAAGGAACAGCTGATTCATCTCGAGATGAATCAGCTGTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005255.1-1196s1c1
Sequence:CCGGCCGTCGCTAATTATGCAAAGGCTCGAGCCTTTGCATAATTAGCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2069s21c1
Sequence:CCGGGAAGATGGCAAAGCGGTGATTCTCGAGAATCACCGCTTTGCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-2290s21c1
Sequence:CCGGCCCGGATTTATTTCAAGTGAACTCGAGTTCACTTGAAATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005255.2-3740s21c1
Sequence:CCGGGAAGATCTGTTGTCCAATCAACTCGAGTTGATTGGACAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132229
GAK MISSION shRNA Bacterial Glycerol Stock
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-2836s1c1
Sequence:CCGGCCTGATCTCTTTGGAGAGTTTCTCGAGAAACTCTCCAAAGAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-592s1c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1111s1c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-3411s1c1
Sequence:CCGGCTTCTCTAAGTCTGACAAGAACTCGAGTTCTTGTCAGACTTAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1737s1c1
Sequence:CCGGGCAGGAATATGACAGAATGAACTCGAGTTCATTCTGTCATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132229
GAK MISSION shRNA shRNA Plasmid DNA
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-2836s1c1
Sequence:CCGGCCTGATCTCTTTGGAGAGTTTCTCGAGAAACTCTCCAAAGAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-592s1c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1111s1c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-3411s1c1
Sequence:CCGGCTTCTCTAAGTCTGACAAGAACTCGAGTTCTTGTCAGACTTAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1737s1c1
Sequence:CCGGGCAGGAATATGACAGAATGAACTCGAGTTCATTCTGTCATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132229
GAK MISSION shRNA Lentiviral Transduction Particles
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-2836s1c1
Sequence:CCGGCCTGATCTCTTTGGAGAGTTTCTCGAGAAACTCTCCAAAGAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-592s1c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1111s1c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-3411s1c1
Sequence:CCGGCTTCTCTAAGTCTGACAAGAACTCGAGTTCTTGTCAGACTTAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132229.5-1737s1c1
Sequence:CCGGGCAGGAATATGACAGAATGAACTCGAGTTCATTCTGTCATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153569
VALIDATED
GAK MISSION shRNA Bacterial Glycerol Stock
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153569.1-779s21c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-4064s21c1
Sequence:CCGGTGGCCTGACTGAGGCACAAATCTCGAGATTTGTGCCTCAGTCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1200s21c1
Sequence:CCGGACGGTGGGTTTCTTGATATTCCTCGAGGAATATCAAGAAACCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-287s21c1
Sequence:CCGGGAGTATGCATTAAAGCGATTACTCGAGTAATCGCTTTAATGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1298s21c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153569
VALIDATED
GAK MISSION shRNA shRNA Plasmid DNA
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153569.1-779s21c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-4064s21c1
Sequence:CCGGTGGCCTGACTGAGGCACAAATCTCGAGATTTGTGCCTCAGTCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1200s21c1
Sequence:CCGGACGGTGGGTTTCTTGATATTCCTCGAGGAATATCAAGAAACCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-287s21c1
Sequence:CCGGGAGTATGCATTAAAGCGATTACTCGAGTAATCGCTTTAATGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1298s21c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153569
VALIDATED
GAK MISSION shRNA Lentiviral Transduction Particles
cyclin G associated kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153569.1-779s21c1
Sequence:CCGGCCAGAAATTGTAGACCTGTATCTCGAGATACAGGTCTACAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-4064s21c1
Sequence:CCGGTGGCCTGACTGAGGCACAAATCTCGAGATTTGTGCCTCAGTCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1200s21c1
Sequence:CCGGACGGTGGGTTTCTTGATATTCCTCGAGGAATATCAAGAAACCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-287s21c1
Sequence:CCGGGAGTATGCATTAAAGCGATTACTCGAGTAATCGCTTTAATGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153569.1-1298s21c1
Sequence:CCGGGCAAAGGGTGATCTGGACATACTCGAGTATGTCCAGATCACCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks