EMAIL THIS PAGE TO A FRIEND

GAL3ST2

galactose-3-O-sulfotransferase 2

36 Gene Product Result for
Synonyms: GAL3ST-2 GP3ST
UniProtKB ID: Q9H3Q3, Q17RK0, Q57Z52
Gene ID:
Human(64090) Summary: This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate group to the hydroxyl at C-3 of nonreducing beta-galactosyl residues, and it can act on both type 1 and type 2 (Galbeta 1-3/1-4GlcNAc-R) oligosaccharides with similar efficiencies, and on core 1 glycans. This enzyme has been implicated in tumor metastasis processes. This gene is different from the GAL3ST3 gene located on chromosome 11, which has also been referred to as GAL3ST2 and encodes a related enzyme with distinct tissue distribution and substrate specificities, compared to galactose-3-O-sulfotransferase 2. [provided by RefSeq, Jul 2008]
Mouse(381334) galactose-3-O-sulfotransferase 2
Rat(685402) galactose-3-O-sulfotransferase 2
naked mole-rat(101707346) galactose-3-O-sulfotransferase 2
sheep(101121227) galactose-3-O-sulfotransferase 2
chicken(424854) galactose-3-O-sulfotransferase 2
cow(523830) galactose-3-O-sulfotransferase 2
dog(486212) galactose-3-O-sulfotransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094851 MISSION® esiRNA esiRNA targeting mouse Gal3st2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022134 Rosetta Predictions human pricing
XM_001063652 Rosetta Predictions rat pricing
NM_199366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021974 predicted 1166
2 SASI_Hs01_00021975 predicted 965
3 SASI_Hs02_00355540 predicted 680
4 SASI_Hs01_00021977 predicted 692
5 SASI_Hs01_00021978 predicted 1110
6 SASI_Hs02_00355541 predicted 680
7 SASI_Hs01_00021979 predicted 1115
8 SASI_Hs01_00021980 predicted 205
9 SASI_Hs01_00021982 predicted 469
10 SASI_Hs02_00355542 predicted 680
11 SASI_Hs01_00021976 predicted 1264
12 SASI_Hs01_00021981 predicted 1270
13 SASI_Hs01_00021983 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307918 predicted 485
2 SASI_Rn02_00307919 predicted 571
3 SASI_Rn02_00307920 predicted 487
4 SASI_Rn02_00307921 predicted 729
5 SASI_Rn02_00307922 predicted 654
6 SASI_Rn02_00307923 predicted 475
7 SASI_Rn02_00307924 predicted 607
8 SASI_Rn02_00307925 predicted 432
9 SASI_Rn02_00307926 predicted 563
10 SASI_Rn02_00307927 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145886 predicted 1281
2 SASI_Mm01_00145887 predicted 1252
3 SASI_Mm01_00145888 predicted 1232
4 SASI_Mm01_00145889 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022134
GAL3ST2 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-577s1c1
Sequence:CCGGTCCTCCTTCATCTACTACAAACTCGAGTTTGTAGTAGATGAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-285s1c1
Sequence:CCGGCACCAACATCATGTTCCTGAACTCGAGTTCAGGAACATGATGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-972s1c1
Sequence:CCGGGCGCCTGTACGAGCATTTCAACTCGAGTTGAAATGCTCGTACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-522s1c1
Sequence:CCGGGCCCAACGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-702s1c1
Sequence:CCGGGAACAACATGTGGTTCGACTTCTCGAGAAGTCGAACCACATGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-477s21c1
Sequence:CCGGTGCAACCACCTGAGGTTCAACCTCGAGGTTGAACCTCAGGTGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-1115s21c1
Sequence:CCGGCAAGAACCACACGCAGATCAGCTCGAGCTGATCTGCGTGTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-327s21c1
Sequence:CCGGACGGTGCTCAACATCCTCTACCTCGAGGTAGAGGATGTTGAGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022134
GAL3ST2 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-577s1c1
Sequence:CCGGTCCTCCTTCATCTACTACAAACTCGAGTTTGTAGTAGATGAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-285s1c1
Sequence:CCGGCACCAACATCATGTTCCTGAACTCGAGTTCAGGAACATGATGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-972s1c1
Sequence:CCGGGCGCCTGTACGAGCATTTCAACTCGAGTTGAAATGCTCGTACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-522s1c1
Sequence:CCGGGCCCAACGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-702s1c1
Sequence:CCGGGAACAACATGTGGTTCGACTTCTCGAGAAGTCGAACCACATGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-477s21c1
Sequence:CCGGTGCAACCACCTGAGGTTCAACCTCGAGGTTGAACCTCAGGTGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-1115s21c1
Sequence:CCGGCAAGAACCACACGCAGATCAGCTCGAGCTGATCTGCGTGTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-327s21c1
Sequence:CCGGACGGTGCTCAACATCCTCTACCTCGAGGTAGAGGATGTTGAGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022134
GAL3ST2 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-577s1c1
Sequence:CCGGTCCTCCTTCATCTACTACAAACTCGAGTTTGTAGTAGATGAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-285s1c1
Sequence:CCGGCACCAACATCATGTTCCTGAACTCGAGTTCAGGAACATGATGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-972s1c1
Sequence:CCGGGCGCCTGTACGAGCATTTCAACTCGAGTTGAAATGCTCGTACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-522s1c1
Sequence:CCGGGCCCAACGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022134.1-702s1c1
Sequence:CCGGGAACAACATGTGGTTCGACTTCTCGAGAAGTCGAACCACATGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-477s21c1
Sequence:CCGGTGCAACCACCTGAGGTTCAACCTCGAGGTTGAACCTCAGGTGGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-1115s21c1
Sequence:CCGGCAAGAACCACACGCAGATCAGCTCGAGCTGATCTGCGTGTGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022134.2-327s21c1
Sequence:CCGGACGGTGCTCAACATCCTCTACCTCGAGGTAGAGGATGTTGAGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199366
GAL3ST2 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-649s1c1
Sequence:CCGGCGATTCCATCTGGTGCTCATTCTCGAGAATGAGCACCAGATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-671s1c1
Sequence:CCGGCAGACTACTTCGATGAGTCTACTCGAGTAGACTCATCGAAGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-841s1c1
Sequence:CCGGCAGCATTTCAATCGCACGTTTCTCGAGAAACGTGCGATTGAAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-970s1c1
Sequence:CCGGCCCAAGAACCTGACACACATACTCGAGTATGTGTGTCAGGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199366
GAL3ST2 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-649s1c1
Sequence:CCGGCGATTCCATCTGGTGCTCATTCTCGAGAATGAGCACCAGATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-671s1c1
Sequence:CCGGCAGACTACTTCGATGAGTCTACTCGAGTAGACTCATCGAAGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-841s1c1
Sequence:CCGGCAGCATTTCAATCGCACGTTTCTCGAGAAACGTGCGATTGAAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-970s1c1
Sequence:CCGGCCCAAGAACCTGACACACATACTCGAGTATGTGTGTCAGGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199366
GAL3ST2 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-649s1c1
Sequence:CCGGCGATTCCATCTGGTGCTCATTCTCGAGAATGAGCACCAGATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-671s1c1
Sequence:CCGGCAGACTACTTCGATGAGTCTACTCGAGTAGACTCATCGAAGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-841s1c1
Sequence:CCGGCAGCATTTCAATCGCACGTTTCTCGAGAAACGTGCGATTGAAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199366.1-970s1c1
Sequence:CCGGCCCAAGAACCTGACACACATACTCGAGTATGTGTGTCAGGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks