EMAIL THIS PAGE TO A FRIEND

GAL3ST3

galactose-3-O-sulfotransferase 3

98 Gene Product Result for
Synonyms: GAL3ST-3 GAL3ST2
UniProtKB ID: Q96A11, Q14D05
Gene ID:
Human(89792) Summary: This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate group to the 3' position of galactose in N-acetyllactosamine in both type 2 (Gal-beta-1-4GlcNAc-R) oligosaccharides and core-2-branched O-glycans, but not on type 1 or core-1-branched structures. This gene, which has also been referred to as GAL3ST2, is different from the GAL3ST2 gene located on chromosome 2 that encodes a related enzyme with distinct tissue distribution and substrate specificities, compared to galactose-3-O-sulfotransferase 3. [provided by RefSeq, Jul 2008]
Mouse(545276) galactose-3-O-sulfotransferase 3
Rat(499302) galactose-3-O-sulfotransferase 3
Horse(100052111) galactose-3-O-sulfotransferase 3
domestic cat(101081672) galactose-3-O-sulfotransferase 3
dog(483717) galactose-3-O-sulfotransferase 3
cow(523401) galactose-3-O-sulfotransferase 3
sheep(101104193) galactose-3-O-sulfotransferase 3
naked mole-rat(101703744) galactose-3-O-sulfotransferase 3
domestic guinea pig(100712914) galactose-3-O-sulfotransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013570 Anti-GAL3ST3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV50151 Anti-GAL3ST3 antibody produced in rabbit affinity isolated antibody bovine, human, mouse, rabbit, rat, horse, canine, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190751 MISSION® esiRNA esiRNA targeting mouse Gal3st3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033036 Rosetta Predictions human pricing
NM_001024290 Rosetta Predictions rat pricing
NM_001024717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016858 predicted 356
2 SASI_Hs01_00016859 predicted 710
3 SASI_Hs01_00016862 predicted 1682
4 SASI_Hs02_00360726 predicted 1854
5 SASI_Hs01_00016860 predicted 606
6 SASI_Hs01_00016861 predicted 318
7 SASI_Hs01_00016863 predicted 510
8 SASI_Hs01_00016864 predicted 744
9 SASI_Hs01_00016865 predicted 358
10 SASI_Hs02_00360727 predicted 608
11 SASI_Hs01_00016856 predicted 888
12 SASI_Hs01_00016857 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095592 predicted 722
2 SASI_Rn01_00095593 predicted 876
3 SASI_Rn02_00202477 predicted 1612
4 SASI_Rn01_00095595 predicted 576
5 SASI_Rn02_00202478 predicted 296
6 SASI_Rn01_00095596 predicted 820
7 SASI_Rn01_00095597 predicted 685
8 SASI_Rn01_00095598 predicted 692
9 SASI_Rn01_00095599 predicted 564
10 SASI_Rn01_00095600 predicted 482
11 SASI_Rn01_00095594 predicted 1487
12 SASI_Rn01_00095601 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287686 predicted 301
2 SASI_Mm02_00287687 predicted 1828
3 SASI_Mm02_00287688 predicted 734
4 SASI_Mm02_00287689 predicted 1727
5 SASI_Mm02_00287690 predicted 795
6 SASI_Mm02_00287691 predicted 578
7 SASI_Mm02_00287692 predicted 703
8 SASI_Mm02_00287693 predicted 1579
9 SASI_Mm02_00287694 predicted 269
10 SASI_Mm02_00287695 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033036
GAL3ST3 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-872s21c1
Sequence:CCGGTCGCCATGTTCGCACACAACACTCGAGTGTTGTGTGCGAACATGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033036.2-1687s21c1
Sequence:CCGGTGAGTCCCTCGCTGAACTTTGCTCGAGCAAAGTTCAGCGAGGGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-992s21c1
Sequence:CCGGTCGTCATGATCGCCGAGTACTCTCGAGAGTACTCGGCGATCATGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-520s21c1
Sequence:CCGGCAGAACATCCTGTTTCGCTTTCTCGAGAAAGCGAAACAGGATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1449s1c1
Sequence:CCGGCCAGTACTCGAACTACCTGTTCTCGAGAACAGGTAGTTCGAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-606s1c1
Sequence:CCGGCCGCAACTTCTCGGCGCACTTCTCGAGAAGTGCGCCGAGAAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1362s1c1
Sequence:CCGGCAAGGTGGACATTATGGGCTACTCGAGTAGCCCATAATGTCCACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-765s1c1
Sequence:CCGGCTTCAGCTACTACAACCAGTACTCGAGTACTGGTTGTAGTAGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-363s1c1
Sequence:CCGGCAGCACCGTAAGCCTTCTCATCTCGAGATGAGAAGGCTTACGGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033036
GAL3ST3 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-872s21c1
Sequence:CCGGTCGCCATGTTCGCACACAACACTCGAGTGTTGTGTGCGAACATGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033036.2-1687s21c1
Sequence:CCGGTGAGTCCCTCGCTGAACTTTGCTCGAGCAAAGTTCAGCGAGGGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-992s21c1
Sequence:CCGGTCGTCATGATCGCCGAGTACTCTCGAGAGTACTCGGCGATCATGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-520s21c1
Sequence:CCGGCAGAACATCCTGTTTCGCTTTCTCGAGAAAGCGAAACAGGATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1449s1c1
Sequence:CCGGCCAGTACTCGAACTACCTGTTCTCGAGAACAGGTAGTTCGAGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-606s1c1
Sequence:CCGGCCGCAACTTCTCGGCGCACTTCTCGAGAAGTGCGCCGAGAAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1362s1c1
Sequence:CCGGCAAGGTGGACATTATGGGCTACTCGAGTAGCCCATAATGTCCACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-765s1c1
Sequence:CCGGCTTCAGCTACTACAACCAGTACTCGAGTACTGGTTGTAGTAGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-363s1c1
Sequence:CCGGCAGCACCGTAAGCCTTCTCATCTCGAGATGAGAAGGCTTACGGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033036
GAL3ST3 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-872s21c1
Sequence:CCGGTCGCCATGTTCGCACACAACACTCGAGTGTTGTGTGCGAACATGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033036.2-1687s21c1
Sequence:CCGGTGAGTCCCTCGCTGAACTTTGCTCGAGCAAAGTTCAGCGAGGGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-992s21c1
Sequence:CCGGTCGTCATGATCGCCGAGTACTCTCGAGAGTACTCGGCGATCATGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033036.2-520s21c1
Sequence:CCGGCAGAACATCCTGTTTCGCTTTCTCGAGAAAGCGAAACAGGATGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1449s1c1
Sequence:CCGGCCAGTACTCGAACTACCTGTTCTCGAGAACAGGTAGTTCGAGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-606s1c1
Sequence:CCGGCCGCAACTTCTCGGCGCACTTCTCGAGAAGTGCGCCGAGAAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-1362s1c1
Sequence:CCGGCAAGGTGGACATTATGGGCTACTCGAGTAGCCCATAATGTCCACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-765s1c1
Sequence:CCGGCTTCAGCTACTACAACCAGTACTCGAGTACTGGTTGTAGTAGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033036.1-363s1c1
Sequence:CCGGCAGCACCGTAAGCCTTCTCATCTCGAGATGAGAAGGCTTACGGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024717
GAL3ST3 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-572s21c1
Sequence:CCGGTGCGAGCACCAGTTCTGTTACCTCGAGGTAACAGAACTGGTGCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-1304s21c1
Sequence:CCGGGCTGCCCAGATTCGTACAAAGCTCGAGCTTTGTACGAATCTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-890s21c1
Sequence:CCGGTACGACCTTGGAGGCGACAATCTCGAGATTGTCGCCTCCAAGGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-693s21c1
Sequence:CCGGTGCCTCCAGACACGATCTATGCTCGAGCATAGATCGTGTCTGGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024717.1-1629s21c1
Sequence:CCGGCTTGAGCCCTGTGTCCAAATGCTCGAGCATTTGGACACAGGGCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024717
GAL3ST3 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-572s21c1
Sequence:CCGGTGCGAGCACCAGTTCTGTTACCTCGAGGTAACAGAACTGGTGCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-1304s21c1
Sequence:CCGGGCTGCCCAGATTCGTACAAAGCTCGAGCTTTGTACGAATCTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-890s21c1
Sequence:CCGGTACGACCTTGGAGGCGACAATCTCGAGATTGTCGCCTCCAAGGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-693s21c1
Sequence:CCGGTGCCTCCAGACACGATCTATGCTCGAGCATAGATCGTGTCTGGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024717.1-1629s21c1
Sequence:CCGGCTTGAGCCCTGTGTCCAAATGCTCGAGCATTTGGACACAGGGCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024717
GAL3ST3 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-572s21c1
Sequence:CCGGTGCGAGCACCAGTTCTGTTACCTCGAGGTAACAGAACTGGTGCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-1304s21c1
Sequence:CCGGGCTGCCCAGATTCGTACAAAGCTCGAGCTTTGTACGAATCTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-890s21c1
Sequence:CCGGTACGACCTTGGAGGCGACAATCTCGAGATTGTCGCCTCCAAGGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024717.1-693s21c1
Sequence:CCGGTGCCTCCAGACACGATCTATGCTCGAGCATAGATCGTGTCTGGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024717.1-1629s21c1
Sequence:CCGGCTTGAGCCCTGTGTCCAAATGCTCGAGCATTTGGACACAGGGCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)