EMAIL THIS PAGE TO A FRIEND

GAL3ST4

galactose-3-O-sulfotransferase 4

71 Gene Product Result for
Synonyms: GAL3ST-4
Gene ID:
Human(79690) Summary: This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate to the C-3' position of galactose residues in O-linked glycoproteins. This enzyme is highly specific for core 1 structures, with asialofetuin, Gal-beta-1,3-GalNAc and Gal-beta-1,3 (GlcNAc-beta-1,6)GalNAc being good substrates. [provided by RefSeq, Jul 2008]
Mouse(330217) galactose-3-O-sulfotransferase 4
Rat(498166) galactose-3-O-sulfotransferase 4
domestic guinea pig(100718399) galactose-3-O-sulfotransferase 4
naked mole-rat(101722263) galactose-3-O-sulfotransferase 4
sheep(101106737) galactose-3-O-sulfotransferase 4
Zebrafish(323222) galactose-3-O-sulfotransferase 4
chicken(429133) galactose-3-O-sulfotransferase 4
dog(489843) galactose-3-O-sulfotransferase 4
cow(520552) galactose-3-O-sulfotransferase 4
domestic cat(101089915) galactose-3-O-sulfotransferase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024637 Rosetta Predictions human pricing
NM_001109064 Rosetta Predictions rat pricing
NM_001033416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136331 predicted 1735
2 SASI_Hs01_00136332 predicted 721
3 SASI_Hs01_00136333 predicted 1514
4 SASI_Hs02_00357019 predicted 1407
5 SASI_Hs01_00136334 predicted 799
6 SASI_Hs01_00136335 predicted 1495
7 SASI_Hs02_00357020 predicted 1755
8 SASI_Hs01_00136336 predicted 1673
9 SASI_Hs01_00136337 predicted 792
10 SASI_Hs01_00136338 predicted 819
11 SASI_Hs01_00136330 predicted 440
12 SASI_Hs01_00136339 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244770 predicted 633
2 SASI_Rn02_00244771 predicted 1391
3 SASI_Rn02_00244772 predicted 1016
4 SASI_Rn02_00244773 predicted 1191
5 SASI_Rn02_00244774 predicted 1784
6 SASI_Rn02_00244775 predicted 1705
7 SASI_Rn02_00244776 predicted 1847
8 SASI_Rn02_00244777 predicted 1685
9 SASI_Rn02_00244778 predicted 1676
10 SASI_Rn02_00244779 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058951 predicted 2799
2 SASI_Mm01_00058952 predicted 2422
3 SASI_Mm01_00058953 predicted 2342
4 SASI_Mm02_00288714 predicted 2793
5 SASI_Mm01_00058955 predicted 2879
6 SASI_Mm02_00288715 predicted 2785
7 SASI_Mm01_00058956 predicted 2631
8 SASI_Mm01_00058957 predicted 1734
9 SASI_Mm01_00058958 predicted 2624
10 SASI_Mm01_00058959 predicted 2729
11 SASI_Mm01_00058950 predicted 1877
12 SASI_Mm01_00058954 predicted 2056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024637
GAL3ST4 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-642s1c1
Sequence:CCGGCACATGAGGTTCAACCTGAAACTCGAGTTTCAGGTTGAACCTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-444s1c1
Sequence:CCGGGTGTTCCTGAAGACACATAAACTCGAGTTTATGTGTCTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-1443s1c1
Sequence:CCGGCTAGCGAAACATTGTCTGGTACTCGAGTACCAGACAATGTTTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1216s21c1
Sequence:CCGGAGCCCTGCCTCTTTCGATTTGCTCGAGCAAATCGAAAGAGGCAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1704s21c1
Sequence:CCGGTATACTTCGGAGTGGATTGAGCTCGAGCTCAATCCACTCCGAAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024637
GAL3ST4 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-642s1c1
Sequence:CCGGCACATGAGGTTCAACCTGAAACTCGAGTTTCAGGTTGAACCTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-444s1c1
Sequence:CCGGGTGTTCCTGAAGACACATAAACTCGAGTTTATGTGTCTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-1443s1c1
Sequence:CCGGCTAGCGAAACATTGTCTGGTACTCGAGTACCAGACAATGTTTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1216s21c1
Sequence:CCGGAGCCCTGCCTCTTTCGATTTGCTCGAGCAAATCGAAAGAGGCAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1704s21c1
Sequence:CCGGTATACTTCGGAGTGGATTGAGCTCGAGCTCAATCCACTCCGAAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024637
GAL3ST4 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-642s1c1
Sequence:CCGGCACATGAGGTTCAACCTGAAACTCGAGTTTCAGGTTGAACCTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-444s1c1
Sequence:CCGGGTGTTCCTGAAGACACATAAACTCGAGTTTATGTGTCTTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024637.3-1443s1c1
Sequence:CCGGCTAGCGAAACATTGTCTGGTACTCGAGTACCAGACAATGTTTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1216s21c1
Sequence:CCGGAGCCCTGCCTCTTTCGATTTGCTCGAGCAAATCGAAAGAGGCAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024637.4-1704s21c1
Sequence:CCGGTATACTTCGGAGTGGATTGAGCTCGAGCTCAATCCACTCCGAAGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033416
GAL3ST4 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2790s21c1
Sequence:CCGGCATAGGTATCAGACTACAAATCTCGAGATTTGTAGTCTGATACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-1886s21c1
Sequence:CCGGTTCCGAAAGGCACCGTCTTTGCTCGAGCAAAGACGGTGCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033416.2-2835s21c1
Sequence:CCGGACCTCTAGGTGCGTATGTATTCTCGAGAATACATACGCACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2697s21c1
Sequence:CCGGCTACTCCAGAGCTACAGTATACTCGAGTATACTGTAGCTCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2645s21c1
Sequence:CCGGGTACTTCAGAGTGGACTAAACCTCGAGGTTTAGTCCACTCTGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033416
GAL3ST4 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2790s21c1
Sequence:CCGGCATAGGTATCAGACTACAAATCTCGAGATTTGTAGTCTGATACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-1886s21c1
Sequence:CCGGTTCCGAAAGGCACCGTCTTTGCTCGAGCAAAGACGGTGCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033416.2-2835s21c1
Sequence:CCGGACCTCTAGGTGCGTATGTATTCTCGAGAATACATACGCACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2697s21c1
Sequence:CCGGCTACTCCAGAGCTACAGTATACTCGAGTATACTGTAGCTCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2645s21c1
Sequence:CCGGGTACTTCAGAGTGGACTAAACCTCGAGGTTTAGTCCACTCTGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033416
GAL3ST4 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2790s21c1
Sequence:CCGGCATAGGTATCAGACTACAAATCTCGAGATTTGTAGTCTGATACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-1886s21c1
Sequence:CCGGTTCCGAAAGGCACCGTCTTTGCTCGAGCAAAGACGGTGCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033416.2-2835s21c1
Sequence:CCGGACCTCTAGGTGCGTATGTATTCTCGAGAATACATACGCACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2697s21c1
Sequence:CCGGCTACTCCAGAGCTACAGTATACTCGAGTATACTGTAGCTCTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033416.2-2645s21c1
Sequence:CCGGGTACTTCAGAGTGGACTAAACCTCGAGGTTTAGTCCACTCTGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks