EMAIL THIS PAGE TO A FRIEND

GAL

galanin/GMAP prepropeptide

Synonyms: GAL-GMAP GALN GLNN GMAP
UniProtKB ID: P22466, Q14413
Gene ID:
Human(51083) Summary: Galanin is small neuropeptide that functions as a cellular messenger within the central and peripheral nervous systems, modulating diverse physiologic functions (Mechenthaler, 2008 [PubMed 18500643]
Mouse(14419) galanin
Rat(29141) galanin/GMAP prepropeptide
naked mole-rat(101716628) galanin/GMAP prepropeptide
domestic guinea pig(101788019) galanin/GMAP prepropeptide
fruit fly(33839) beta galactosidase
dog(404001) galanin/GMAP prepropeptide
chicken(423117) galanin prepropeptide
cow(280799) galanin prepropeptide
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015973 Rosetta Predictions human pricing
NM_033237 Rosetta Predictions rat pricing
NM_010253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101106 predicted 321
2 SASI_Hs01_00101107 predicted 410
3 SASI_Hs01_00101108 predicted 407
4 SASI_Hs01_00101109 predicted 472
5 SASI_Hs01_00101110 predicted 471
6 SASI_Hs01_00101111 predicted 417
7 SASI_Hs01_00101112 predicted 343
8 SASI_Hs01_00101113 predicted 329
9 SASI_Hs01_00101114 predicted 359
10 SASI_Hs01_00101115 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265521 predicted 419
2 SASI_Rn01_00077835 predicted 287
3 SASI_Rn01_00077836 predicted 397
4 SASI_Rn02_00265522 predicted 329
5 SASI_Rn01_00077837 predicted 405
6 SASI_Rn01_00077838 predicted 391
7 SASI_Rn01_00077839 predicted 274
8 SASI_Rn01_00077840 predicted 281
9 SASI_Rn01_00077842 predicted 410
10 SASI_Rn01_00077843 predicted 329
11 SASI_Rn01_00077841 predicted 281
12 SASI_Rn01_00077844 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106462 predicted 244
2 SASI_Mm01_00106464 predicted 402
3 SASI_Mm01_00106465 predicted 294
4 SASI_Mm01_00106466 predicted 398
5 SASI_Mm02_00318145 predicted 390
6 SASI_Mm01_00106468 predicted 285
7 SASI_Mm01_00106471 predicted 319
8 SASI_Mm02_00318146 predicted 400
9 SASI_Mm02_00318147 predicted 405
10 SASI_Mm02_00318148 predicted 408
11 SASI_Mm01_00106463 predicted 427
12 SASI_Mm01_00106467 predicted 426
13 SASI_Mm01_00106469 predicted 276
14 SASI_Mm01_00106470 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015973
VALIDATED
GAL MISSION shRNA Bacterial Glycerol Stock
galanin/GMAP prepropeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-442s21c1
Sequence:CCGGGAAGCTTTGACAGGTCCATACCTCGAGGTATGGACCTGTCAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-371s21c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-420s21c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-625s21c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-590s21c1
Sequence:CCGGAGAGCCTCCTGGGCATGTTTGCTCGAGCAAACATGCCCAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-583s1c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-329s1c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-378s1c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-439s1c1
Sequence:CCGGGCACAATCATTGAGTTTCTGTCTCGAGACAGAAACTCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-437s1c1
Sequence:CCGGGCGCACAATCATTGAGTTTCTCTCGAGAGAAACTCAATGATTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015973
VALIDATED
GAL MISSION shRNA shRNA Plasmid DNA
galanin/GMAP prepropeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-442s21c1
Sequence:CCGGGAAGCTTTGACAGGTCCATACCTCGAGGTATGGACCTGTCAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-371s21c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-420s21c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-625s21c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-590s21c1
Sequence:CCGGAGAGCCTCCTGGGCATGTTTGCTCGAGCAAACATGCCCAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-583s1c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-329s1c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-378s1c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-439s1c1
Sequence:CCGGGCACAATCATTGAGTTTCTGTCTCGAGACAGAAACTCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-437s1c1
Sequence:CCGGGCGCACAATCATTGAGTTTCTCTCGAGAGAAACTCAATGATTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015973
VALIDATED
GAL MISSION shRNA Lentiviral Transduction Particles
galanin/GMAP prepropeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-442s21c1
Sequence:CCGGGAAGCTTTGACAGGTCCATACCTCGAGGTATGGACCTGTCAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-371s21c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-420s21c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-625s21c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015973.3-590s21c1
Sequence:CCGGAGAGCCTCCTGGGCATGTTTGCTCGAGCAAACATGCCCAGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-583s1c1
Sequence:CCGGCCTGAAGTCAAACCTTAAGATCTCGAGATCTTAAGGTTTGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-329s1c1
Sequence:CCGGCAGGTCATTCAGCGACAAGAACTCGAGTTCTTGTCGCTGAATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-378s1c1
Sequence:CCGGCCCGAAGATGACATGAAACCACTCGAGTGGTTTCATGTCATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-439s1c1
Sequence:CCGGGCACAATCATTGAGTTTCTGTCTCGAGACAGAAACTCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015973.2-437s1c1
Sequence:CCGGGCGCACAATCATTGAGTTTCTCTCGAGAGAAACTCAATGATTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010253
GAL MISSION shRNA Bacterial Glycerol Stock
galanin/GMAP prepropeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.3-287s1c1
Sequence:CCGGCATTGACAACCACAGATCATTCTCGAGAATGATCTGTGGTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-401s21c1
Sequence:CCGGCAACATTGTCCGCACTATAATCTCGAGATTATAGTGCGGACAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-364s21c1
Sequence:CCGGGGAGACCAGGAAGTGTTGATGCTCGAGCATCAACACTTCCTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-289s21c1
Sequence:CCGGTTGACAACCACAGATCATTTACTCGAGTAAATGATCTGTGGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-325s21c1
Sequence:CCGGTCACAGGCAAGAGGGAGTTACCTCGAGGTAACTCCCTCTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-492s21c1
Sequence:CCGGACCTCCTCAGAAGACCTAGAGCTCGAGCTCTAGGTCTTCTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-496s1c1
Sequence:CCGGCCTCAGAAGACCTAGAGAAGTCTCGAGACTTCTCTAGGTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-400s1c1
Sequence:CCGGGCAACATTGTCCGCACTATAACTCGAGTTATAGTGCGGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010253
GAL MISSION shRNA shRNA Plasmid DNA
galanin/GMAP prepropeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.3-287s1c1
Sequence:CCGGCATTGACAACCACAGATCATTCTCGAGAATGATCTGTGGTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-401s21c1
Sequence:CCGGCAACATTGTCCGCACTATAATCTCGAGATTATAGTGCGGACAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-364s21c1
Sequence:CCGGGGAGACCAGGAAGTGTTGATGCTCGAGCATCAACACTTCCTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-289s21c1
Sequence:CCGGTTGACAACCACAGATCATTTACTCGAGTAAATGATCTGTGGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-325s21c1
Sequence:CCGGTCACAGGCAAGAGGGAGTTACCTCGAGGTAACTCCCTCTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-492s21c1
Sequence:CCGGACCTCCTCAGAAGACCTAGAGCTCGAGCTCTAGGTCTTCTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-496s1c1
Sequence:CCGGCCTCAGAAGACCTAGAGAAGTCTCGAGACTTCTCTAGGTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-400s1c1
Sequence:CCGGGCAACATTGTCCGCACTATAACTCGAGTTATAGTGCGGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010253
GAL MISSION shRNA Lentiviral Transduction Particles
galanin/GMAP prepropeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.3-287s1c1
Sequence:CCGGCATTGACAACCACAGATCATTCTCGAGAATGATCTGTGGTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-401s21c1
Sequence:CCGGCAACATTGTCCGCACTATAATCTCGAGATTATAGTGCGGACAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-364s21c1
Sequence:CCGGGGAGACCAGGAAGTGTTGATGCTCGAGCATCAACACTTCCTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-289s21c1
Sequence:CCGGTTGACAACCACAGATCATTTACTCGAGTAAATGATCTGTGGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-325s21c1
Sequence:CCGGTCACAGGCAAGAGGGAGTTACCTCGAGGTAACTCCCTCTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010253.3-492s21c1
Sequence:CCGGACCTCCTCAGAAGACCTAGAGCTCGAGCTCTAGGTCTTCTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-496s1c1
Sequence:CCGGCCTCAGAAGACCTAGAGAAGTCTCGAGACTTCTCTAGGTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010253.2-400s1c1
Sequence:CCGGGCAACATTGTCCGCACTATAACTCGAGTTATAGTGCGGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks