EMAIL THIS PAGE TO A FRIEND

GALC

galactosylceramidase

173 Gene Product Result for
Gene ID:
Human(2581) Summary: This gene encodes a lysosomal protein which hydrolyzes the galactose ester bonds of galactosylceramide, galactosylsphingosine, lactosylceramide, and monogalactosyldiglyceride. Mutations in this gene have been associated with Krabbe disease, also known as globoid cell leukodystrophy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(14420) galactosylceramidase
Rat(314360) galactosylceramidase
chicken(423394) galactosylceramidase
domestic cat(101084116) galactosylceramidase
Horse(100034130) galactosylceramidase
cow(533428) galactosylceramidase
dog(403916) galactosylceramidase
sheep(101118106) galactosylceramidase
naked mole-rat(101721890) galactosylceramidase
domestic guinea pig(100731753) galactosylceramidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000153 Rosetta Predictions human pricing
NM_001037525 Rosetta Predictions human pricing
NM_001005888 Rosetta Predictions rat pricing
XM_579148 Rosetta Predictions rat pricing
NM_008079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214643 predicted 1300
2 SASI_Hs01_00214646 predicted 1151
3 SASI_Hs02_00301968 predicted 1203
4 SASI_Hs02_00301969 predicted 632
5 SASI_Hs01_00214648 predicted 1293
6 SASI_Hs01_00214649 predicted 947
7 SASI_Hs01_00214650 predicted 1209
8 SASI_Hs01_00214651 predicted 744
9 SASI_Hs01_00214652 predicted 746
10 SASI_Hs02_00301970 predicted 807
11 SASI_Hs01_00214644 predicted 999
12 SASI_Hs01_00214645 predicted 831
13 SASI_Hs01_00214647 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089561 predicted 1299
2 SASI_Hs01_00089564 predicted 1151
3 SASI_Hs02_00308307 predicted 1204
4 SASI_Hs02_00308308 predicted 626
5 SASI_Hs01_00089566 predicted 1288
6 SASI_Hs01_00089567 predicted 948
7 SASI_Hs01_00089568 predicted 1212
8 SASI_Hs01_00089569 predicted 739
9 SASI_Hs01_00089570 predicted 745
10 SASI_Hs02_00308309 predicted 808
11 SASI_Hs01_00089562 predicted 1000
12 SASI_Hs01_00089563 predicted 834
13 SASI_Hs01_00089565 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198473 predicted 233
2 SASI_Rn01_00061272 predicted 371
3 SASI_Rn01_00061273 predicted 940
4 SASI_Rn01_00061274 predicted 1533
5 SASI_Rn01_00061275 predicted 242
6 SASI_Rn01_00061276 predicted 553
7 SASI_Rn02_00198474 predicted 592
8 SASI_Rn01_00061277 predicted 387
9 SASI_Rn01_00061278 predicted 599
10 SASI_Rn01_00061279 predicted 891
11 SASI_Rn01_00061280 predicted 205
12 SASI_Rn01_00061281 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154390 predicted 240
2 SASI_Rn01_00154391 predicted 374
3 SASI_Rn01_00154392 predicted 351
4 SASI_Rn01_00154393 predicted 1537
5 SASI_Rn01_00154394 predicted 241
6 SASI_Rn01_00154395 predicted 240
7 SASI_Rn01_00154396 predicted 1833
8 SASI_Rn01_00154397 predicted 389
9 SASI_Rn01_00154398 predicted 205
10 SASI_Rn01_00154399 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150963 predicted 381
2 SASI_Mm01_00150964 predicted 1200
3 SASI_Mm01_00150965 predicted 256
4 SASI_Mm01_00150966 predicted 1893
5 SASI_Mm01_00150967 predicted 569
6 SASI_Mm01_00150968 predicted 1469
7 SASI_Mm01_00150970 predicted 2129
8 SASI_Mm01_00150971 predicted 1149
9 SASI_Mm01_00150972 predicted 1641
10 SASI_Mm02_00313089 predicted 1189
11 SASI_Mm01_00150969 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000153
VALIDATED
GALC MISSION shRNA Bacterial Glycerol Stock
galactosylceramidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-599s21c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1851s21c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-2297s21c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1206s21c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-443s1c1
Sequence:CCGGGCCCTATCGTTCTCAGATATTCTCGAGAATATCTGAGAACGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1667s1c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1022s1c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-2113s1c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-415s1c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000153
VALIDATED
GALC MISSION shRNA shRNA Plasmid DNA
galactosylceramidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-599s21c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1851s21c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-2297s21c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1206s21c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-443s1c1
Sequence:CCGGGCCCTATCGTTCTCAGATATTCTCGAGAATATCTGAGAACGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1667s1c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1022s1c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-2113s1c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-415s1c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000153
VALIDATED
GALC MISSION shRNA Lentiviral Transduction Particles
galactosylceramidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-599s21c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1851s21c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-2297s21c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000153.2-1206s21c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-443s1c1
Sequence:CCGGGCCCTATCGTTCTCAGATATTCTCGAGAATATCTGAGAACGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1667s1c1
Sequence:CCGGGCCCTTCCCAAGTACCTATAACTCGAGTTATAGGTACTTGGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-1022s1c1
Sequence:CCGGGCTTTGGTCTTCTGAAGACTTCTCGAGAAGTCTTCAGAAGACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-2113s1c1
Sequence:CCGGCGTTAACTATTAAGGGTCATTCTCGAGAATGACCCTTAATAGTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000153.1-415s1c1
Sequence:CCGGCCTCCCGACTTCTAGTAAATTCTCGAGAATTTACTAGAAGTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008079
VALIDATED
GALC MISSION shRNA Bacterial Glycerol Stock
galactosylceramidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-445s1c1
Sequence:CCGGGAGAATTATTTCCGAGGCTATCTCGAGATAGCCTCGGAAATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008079.1-957s1c1
Sequence:CCGGCCAGAATTACATCAATGGCAACTCGAGTTGCCATTGATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-304s1c1
Sequence:CCGGGAGCCCTATCGTTCTGAAATACTCGAGTATTTCAGAACGATAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-1973s1c1
Sequence:CCGGCCTTAGGCATTAAGGGTTATTCTCGAGAATAACCCTTAATGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-496s1c1
Sequence:CCGGCGGAACCCAGATATTATACTTCTCGAGAAGTATAATATCTGGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008079
VALIDATED
GALC MISSION shRNA shRNA Plasmid DNA
galactosylceramidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-445s1c1
Sequence:CCGGGAGAATTATTTCCGAGGCTATCTCGAGATAGCCTCGGAAATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008079.1-957s1c1
Sequence:CCGGCCAGAATTACATCAATGGCAACTCGAGTTGCCATTGATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-304s1c1
Sequence:CCGGGAGCCCTATCGTTCTGAAATACTCGAGTATTTCAGAACGATAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-1973s1c1
Sequence:CCGGCCTTAGGCATTAAGGGTTATTCTCGAGAATAACCCTTAATGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-496s1c1
Sequence:CCGGCGGAACCCAGATATTATACTTCTCGAGAAGTATAATATCTGGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008079
VALIDATED
GALC MISSION shRNA Lentiviral Transduction Particles
galactosylceramidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-445s1c1
Sequence:CCGGGAGAATTATTTCCGAGGCTATCTCGAGATAGCCTCGGAAATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008079.1-957s1c1
Sequence:CCGGCCAGAATTACATCAATGGCAACTCGAGTTGCCATTGATGTAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-304s1c1
Sequence:CCGGGAGCCCTATCGTTCTGAAATACTCGAGTATTTCAGAACGATAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-1973s1c1
Sequence:CCGGCCTTAGGCATTAAGGGTTATTCTCGAGAATAACCCTTAATGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008079.1-496s1c1
Sequence:CCGGCGGAACCCAGATATTATACTTCTCGAGAAGTATAATATCTGGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks