EMAIL THIS PAGE TO A FRIEND

GALE

UDP-galactose-4-epimerase

116 Gene Product Result for
Synonyms: SDR1E1
UniProtKB ID: Q14376, Q86W41, Q9BVE3, Q9UJB4
Gene ID:
Human(2582) Summary: This gene encodes UDP-galactose-4-epimerase which catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. The bifunctional nature of the enzyme has the important metabolic consequence that mutant cells (or individuals) are dependent not only on exogenous galactose, but also on exogenous N-acetylgalactosamine as a necessary precursor for the synthesis of glycoproteins and glycolipids. Mutations in this gene result in epimerase-deficiency galactosemia, also referred to as galactosemia type 3, a disease characterized by liver damage, early-onset cataracts, deafness and mental retardation, with symptoms ranging from mild ('peripheral' form) to severe ('generalized' form). Multiple alternatively spliced transcripts encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(74246) galactose-4-epimerase, UDP
Rat(114860) UDP-galactose-4-epimerase
Zebrafish(678540) UDP-galactose-4-epimerase
chicken(419686) UDP-galactose-4-epimerase
fruit fly(38076) UDP-galactose 4'-epimerase
dog(487373) UDP-galactose-4-epimerase
cow(523154) UDP-galactose-4-epimerase
domestic cat(101099312) UDP-galactose-4-epimerase
domestic guinea pig(100722082) UDP-galactose-4-epimerase
naked mole-rat(101714632) UDP-galactose-4-epimerase
sheep(101120144) UDP-galactose-4-epimerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000403 Rosetta Predictions human pricing
NM_001008216 Rosetta Predictions human pricing
NM_001127621 Rosetta Predictions human pricing
NM_080783 Rosetta Predictions rat pricing
NM_178389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108479 predicted 684
2 SASI_Hs01_00108480 predicted 1087
3 SASI_Hs01_00108481 predicted 837
4 SASI_Hs01_00108482 predicted 536
5 SASI_Hs01_00108483 predicted 529
6 SASI_Hs01_00108485 predicted 839
7 SASI_Hs02_00302482 predicted 400
8 SASI_Hs02_00302483 predicted 764
9 SASI_Hs02_00302484 predicted 681
10 SASI_Hs02_00302485 predicted 412
11 SASI_Hs01_00108478 predicted 1404
12 SASI_Hs01_00108484 predicted 1197
13 SASI_Hs01_00108486 predicted 1406
14 SASI_Hs01_00108487 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213104 predicted 617
2 SASI_Hs01_00213105 predicted 1025
3 SASI_Hs01_00213106 predicted 770
4 SASI_Hs01_00213107 predicted 463
5 SASI_Hs01_00213108 predicted 468
6 SASI_Hs01_00213110 predicted 780
7 SASI_Hs02_00305371 predicted 333
8 SASI_Hs02_00305372 predicted 702
9 SASI_Hs02_00305373 predicted 618
10 SASI_Hs02_00305374 predicted 341
11 SASI_Hs01_00213103 predicted 1342
12 SASI_Hs01_00213109 predicted 1135
13 SASI_Hs01_00213111 predicted 1342
14 SASI_Hs01_00213112 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329894 predicted 659
2 SASI_Hs02_00329895 predicted 1063
3 SASI_Hs02_00329896 predicted 814
4 SASI_Hs02_00329897 predicted 509
5 SASI_Hs02_00329898 predicted 508
6 SASI_Hs02_00329899 predicted 816
7 SASI_Hs02_00329900 predicted 375
8 SASI_Hs02_00329901 predicted 745
9 SASI_Hs02_00329902 predicted 656
10 SASI_Hs02_00329903 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072281 predicted 928
2 SASI_Rn01_00072276 predicted 510
3 SASI_Rn02_00267303 predicted 255
4 SASI_Rn01_00072277 predicted 1074
5 SASI_Rn01_00072279 predicted 741
6 SASI_Rn01_00072282 predicted 678
7 SASI_Rn01_00072283 predicted 773
8 SASI_Rn02_00267304 predicted 939
9 SASI_Rn01_00072285 predicted 497
10 SASI_Rn02_00267305 predicted 657
11 SASI_Rn01_00072278 predicted 313
12 SASI_Rn01_00072280 predicted 418
13 SASI_Rn01_00072284 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084695 predicted 1291
2 SASI_Mm01_00084696 predicted 468
3 SASI_Mm01_00084697 predicted 779
4 SASI_Mm01_00084698 predicted 817
5 SASI_Mm01_00084699 predicted 918
6 SASI_Mm01_00084700 predicted 881
7 SASI_Mm02_00348798 predicted 768
8 SASI_Mm01_00084703 predicted 1208
9 SASI_Mm01_00084704 predicted 728
10 SASI_Mm02_00348799 predicted 462
11 SASI_Mm01_00084701 predicted 202
12 SASI_Mm01_00084702 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178389
VALIDATED
GALE MISSION shRNA Bacterial Glycerol Stock
UDP-galactose-4-epimerase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1366s1c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-654s1c1
Sequence:CCGGGTTCTTCATCGAGGAGATGATCTCGAGATCATCTCCTCGATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-639s1c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178389.2-268s1c1
Sequence:CCGGGACAACTTCCATAACGCCATTCTCGAGAATGGCGTTATGGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178389.2-259s1c1
Sequence:CCGGGTGGTCATTGACAACTTCCATCTCGAGATGGAAGTTGTCAATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1365s1c1
Sequence:CCGGCCAGAAAGAAGTCCAGGTCTTCTCGAGAAGACCTGGACTTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-639s21c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-262s21c1
Sequence:CCGGGTCATTGACAACTTCCATAACCTCGAGGTTATGGAAGTTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-467s21c1
Sequence:CCGGAGAAGCCTCTGGACTACTATACTCGAGTATAGTAGTCCAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-384s21c1
Sequence:CCGGAGCCCTACAGCACCTCTTTAACTCGAGTTAAAGAGGTGCTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178389.3-1366s21c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178389
VALIDATED
GALE MISSION shRNA shRNA Plasmid DNA
UDP-galactose-4-epimerase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1366s1c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-654s1c1
Sequence:CCGGGTTCTTCATCGAGGAGATGATCTCGAGATCATCTCCTCGATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-639s1c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178389.2-268s1c1
Sequence:CCGGGACAACTTCCATAACGCCATTCTCGAGAATGGCGTTATGGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178389.2-259s1c1
Sequence:CCGGGTGGTCATTGACAACTTCCATCTCGAGATGGAAGTTGTCAATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1365s1c1
Sequence:CCGGCCAGAAAGAAGTCCAGGTCTTCTCGAGAAGACCTGGACTTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-639s21c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-262s21c1
Sequence:CCGGGTCATTGACAACTTCCATAACCTCGAGGTTATGGAAGTTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-467s21c1
Sequence:CCGGAGAAGCCTCTGGACTACTATACTCGAGTATAGTAGTCCAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-384s21c1
Sequence:CCGGAGCCCTACAGCACCTCTTTAACTCGAGTTAAAGAGGTGCTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178389.3-1366s21c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178389
VALIDATED
GALE MISSION shRNA Lentiviral Transduction Particles
UDP-galactose-4-epimerase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1366s1c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-654s1c1
Sequence:CCGGGTTCTTCATCGAGGAGATGATCTCGAGATCATCTCCTCGATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-639s1c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178389.2-268s1c1
Sequence:CCGGGACAACTTCCATAACGCCATTCTCGAGAATGGCGTTATGGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178389.2-259s1c1
Sequence:CCGGGTGGTCATTGACAACTTCCATCTCGAGATGGAAGTTGTCAATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178389.2-1365s1c1
Sequence:CCGGCCAGAAAGAAGTCCAGGTCTTCTCGAGAAGACCTGGACTTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-639s21c1
Sequence:CCGGCTACGGCAAGTCCAAGTTCTTCTCGAGAAGAACTTGGACTTGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-262s21c1
Sequence:CCGGGTCATTGACAACTTCCATAACCTCGAGGTTATGGAAGTTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-467s21c1
Sequence:CCGGAGAAGCCTCTGGACTACTATACTCGAGTATAGTAGTCCAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178389.3-384s21c1
Sequence:CCGGAGCCCTACAGCACCTCTTTAACTCGAGTTAAAGAGGTGCTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178389.3-1366s21c1
Sequence:CCGGCAGAAAGAAGTCCAGGTCTTTCTCGAGAAAGACCTGGACTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000403
VALIDATED
GALE MISSION shRNA Bacterial Glycerol Stock
UDP-galactose-4-epimerase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-378s1c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-172s1c1
Sequence:CCGGCGATAACTTCCATAATGCCTTCTCGAGAAGGCATTATGGAAGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-555s1c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-689s1c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-313s1c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-536s21c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-847s21c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-471s21c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-713s21c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000403
VALIDATED
GALE MISSION shRNA shRNA Plasmid DNA
UDP-galactose-4-epimerase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-378s1c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-172s1c1
Sequence:CCGGCGATAACTTCCATAATGCCTTCTCGAGAAGGCATTATGGAAGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-555s1c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-689s1c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-313s1c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-536s21c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-847s21c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-471s21c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-713s21c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000403
VALIDATED
GALE MISSION shRNA Lentiviral Transduction Particles
UDP-galactose-4-epimerase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-378s1c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-172s1c1
Sequence:CCGGCGATAACTTCCATAATGCCTTCTCGAGAAGGCATTATGGAAGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-555s1c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-689s1c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000403.2-313s1c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-536s21c1
Sequence:CCGGCTCTGGATTATTACAGAGTTACTCGAGTAACTCTGTAATAATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-847s21c1
Sequence:CCGGCCCAACAACCTCATGCCTTATCTCGAGATAAGGCATGAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-471s21c1
Sequence:CCGGGTACAGCTTTATGGCGGTCATCTCGAGATGACCGCCATAAAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000403.3-713s21c1
Sequence:CCGGCCAAGTTCTTCATCGAGGAAACTCGAGTTTCCTCGATGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks