EMAIL THIS PAGE TO A FRIEND

GALK1

galactokinase 1

71 Gene Product Result for
Synonyms: GALK GK1
UniProtKB ID: P51570, B2RC07
Gene ID:
Human(2584) Summary: Galactokinase is a major enzyme for the metabolism of galactose and its deficiency causes congenital cataracts during infancy and presenile cataracts in the adult population. [provided by RefSeq, Jul 2008]
Mouse(14635) galactokinase 1
Rat(287835) galactokinase 1
Zebrafish(449829) galactokinase 1
cow(530855) galactokinase 1
domestic cat(101095211) galactokinase 1
dog(403694) galactokinase 1
chicken(417373) galactokinase 1
sheep(101119657) galactokinase 1
naked mole-rat(101726464) galactokinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000154 Rosetta Predictions human pricing
NM_001008282 Rosetta Predictions rat pricing
NM_016905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040447 predicted 378
2 SASI_Hs01_00040448 predicted 990
3 SASI_Hs01_00040449 predicted 830
4 SASI_Hs01_00040450 predicted 491
5 SASI_Hs01_00040451 predicted 473
6 SASI_Hs01_00040453 predicted 937
7 SASI_Hs02_00301971 predicted 967
8 SASI_Hs01_00040454 predicted 287
9 SASI_Hs01_00040455 predicted 616
10 SASI_Hs01_00040456 predicted 957
11 SASI_Hs01_00040452 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094453 predicted 952
2 SASI_Rn02_00198981 predicted 947
3 SASI_Rn01_00094454 predicted 224
4 SASI_Rn01_00094455 predicted 681
5 SASI_Rn01_00094456 predicted 728
6 SASI_Rn01_00094457 predicted 1022
7 SASI_Rn01_00094458 predicted 1034
8 SASI_Rn02_00198982 predicted 1021
9 SASI_Rn01_00094459 predicted 469
10 SASI_Rn01_00094460 predicted 654
11 SASI_Rn01_00094461 predicted 991
12 SASI_Rn01_00094462 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323758 predicted 909
2 SASI_Mm01_00177824 predicted 954
3 SASI_Mm01_00177825 predicted 470
4 SASI_Mm01_00177826 predicted 625
5 SASI_Mm01_00177827 predicted 351
6 SASI_Mm01_00177828 predicted 479
7 SASI_Mm01_00177829 predicted 447
8 SASI_Mm01_00177830 predicted 971
9 SASI_Mm01_00177831 predicted 357
10 SASI_Mm01_00177833 predicted 745
11 SASI_Mm01_00177832 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000154
VALIDATED
GALK1 MISSION shRNA Bacterial Glycerol Stock
galactokinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-659s21c1
Sequence:CCGGTGCTCATTGACTGCAGGTCCTCTCGAGAGGACCTGCAGTCAATGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-386s21c1
Sequence:CCGGACTATGTCAAGGGAGTGATTCCTCGAGGAATCACTCCCTTGACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-618s21c1
Sequence:CCGGGGACCAGTTCATCTCACTTATCTCGAGATAAGTGAGATGAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-998s21c1
Sequence:CCGGGCTCACTCAGAGACGACTATGCTCGAGCATAGTCGTCTCTGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-862s21c1
Sequence:CCGGAGGGACCTGGTGAGCAAAGAGCTCGAGCTCTTTGCTCACCAGGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-380s1c1
Sequence:CCGGGGGCCAACTATGTCAAGGGAGCTCGAGCTCCCTTGACATAGTTGGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-835s1c1
Sequence:CCGGGTACAACTGGAAGAGCTAGAGCTCGAGCTCTAGCTCTTCCAGTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-729s1c1
Sequence:CCGGCACCAACTCTAATGTCCGCCACTCGAGTGGCGGACATTAGAGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-535s1c1
Sequence:CCGGCCAGACTCGGGCACAATAGCTCTCGAGAGCTATTGTGCCCGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-1007s1c1
Sequence:CCGGGAGACGACTATGAGGTGAGCTCTCGAGAGCTCACCTCATAGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-229s1c1
Sequence:CCGGGCTCTGGAGCTCATGACGGTGCTCGAGCACCGTCATGAGCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-494s1c1
Sequence:CCGGCCTTGGAAGTGGCCACGTACACTCGAGTGTACGTGGCCACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-944s1c1
Sequence:CCGGCCCTGAGACGTGGCGACTACACTCGAGTGTAGTCGCCACGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000154
VALIDATED
GALK1 MISSION shRNA shRNA Plasmid DNA
galactokinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-659s21c1
Sequence:CCGGTGCTCATTGACTGCAGGTCCTCTCGAGAGGACCTGCAGTCAATGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-386s21c1
Sequence:CCGGACTATGTCAAGGGAGTGATTCCTCGAGGAATCACTCCCTTGACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-618s21c1
Sequence:CCGGGGACCAGTTCATCTCACTTATCTCGAGATAAGTGAGATGAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-998s21c1
Sequence:CCGGGCTCACTCAGAGACGACTATGCTCGAGCATAGTCGTCTCTGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-862s21c1
Sequence:CCGGAGGGACCTGGTGAGCAAAGAGCTCGAGCTCTTTGCTCACCAGGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-380s1c1
Sequence:CCGGGGGCCAACTATGTCAAGGGAGCTCGAGCTCCCTTGACATAGTTGGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-835s1c1
Sequence:CCGGGTACAACTGGAAGAGCTAGAGCTCGAGCTCTAGCTCTTCCAGTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-729s1c1
Sequence:CCGGCACCAACTCTAATGTCCGCCACTCGAGTGGCGGACATTAGAGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-535s1c1
Sequence:CCGGCCAGACTCGGGCACAATAGCTCTCGAGAGCTATTGTGCCCGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-1007s1c1
Sequence:CCGGGAGACGACTATGAGGTGAGCTCTCGAGAGCTCACCTCATAGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-229s1c1
Sequence:CCGGGCTCTGGAGCTCATGACGGTGCTCGAGCACCGTCATGAGCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-494s1c1
Sequence:CCGGCCTTGGAAGTGGCCACGTACACTCGAGTGTACGTGGCCACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-944s1c1
Sequence:CCGGCCCTGAGACGTGGCGACTACACTCGAGTGTAGTCGCCACGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000154
VALIDATED
GALK1 MISSION shRNA Lentiviral Transduction Particles
galactokinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-659s21c1
Sequence:CCGGTGCTCATTGACTGCAGGTCCTCTCGAGAGGACCTGCAGTCAATGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-386s21c1
Sequence:CCGGACTATGTCAAGGGAGTGATTCCTCGAGGAATCACTCCCTTGACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-618s21c1
Sequence:CCGGGGACCAGTTCATCTCACTTATCTCGAGATAAGTGAGATGAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-998s21c1
Sequence:CCGGGCTCACTCAGAGACGACTATGCTCGAGCATAGTCGTCTCTGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000154.1-862s21c1
Sequence:CCGGAGGGACCTGGTGAGCAAAGAGCTCGAGCTCTTTGCTCACCAGGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-380s1c1
Sequence:CCGGGGGCCAACTATGTCAAGGGAGCTCGAGCTCCCTTGACATAGTTGGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-835s1c1
Sequence:CCGGGTACAACTGGAAGAGCTAGAGCTCGAGCTCTAGCTCTTCCAGTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000154.x-729s1c1
Sequence:CCGGCACCAACTCTAATGTCCGCCACTCGAGTGGCGGACATTAGAGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000154.x-535s1c1
Sequence:CCGGCCAGACTCGGGCACAATAGCTCTCGAGAGCTATTGTGCCCGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-1007s1c1
Sequence:CCGGGAGACGACTATGAGGTGAGCTCTCGAGAGCTCACCTCATAGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000154.1-229s1c1
Sequence:CCGGGCTCTGGAGCTCATGACGGTGCTCGAGCACCGTCATGAGCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-494s1c1
Sequence:CCGGCCTTGGAAGTGGCCACGTACACTCGAGTGTACGTGGCCACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_000154.1-944s1c1
Sequence:CCGGCCCTGAGACGTGGCGACTACACTCGAGTGTAGTCGCCACGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016905
VALIDATED
GALK1 MISSION shRNA Bacterial Glycerol Stock
galactokinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-241s21c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-709s21c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-1125s21c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-974s21c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-197s1c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-930s1c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-665s1c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-1081s1c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016905
VALIDATED
GALK1 MISSION shRNA shRNA Plasmid DNA
galactokinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-241s21c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-709s21c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-1125s21c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-974s21c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-197s1c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-930s1c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-665s1c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-1081s1c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016905
VALIDATED
GALK1 MISSION shRNA Lentiviral Transduction Particles
galactokinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-241s21c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-709s21c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-1125s21c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016905.2-974s21c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-197s1c1
Sequence:CCGGCCCGGACAGATGGGCTTGTTTCTCGAGAAACAAGCCCATCTGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-930s1c1
Sequence:CCGGCTACTCACTCAGGGATGACTACTCGAGTAGTCATCCCTGAGTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016905.1-665s1c1
Sequence:CCGGCCAACTCCAATGTCCGCCATTCTCGAGAATGGCGGACATTGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016905.1-1081s1c1
Sequence:CCGGCCTCTTGTCATAGATCATATACTCGAGTATATGATCTATGACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks