EMAIL THIS PAGE TO A FRIEND

GALK2

galactokinase 2

107 Gene Product Result for
Synonyms: GK2
UniProtKB ID: Q01415, Q7Z4Q4
Gene ID:
Human(2585) Summary: This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(69976) galactokinase 2
Rat(296117) galactokinase 2
naked mole-rat(101714414) galactokinase 2
sheep(101108754) galactokinase 2
Domestic Rabbit(100349778) galactokinase 2
Zebrafish(792268) galactokinase 2
chicken(415596) galactokinase 2
domestic cat(101097562) galactokinase 2
cow(536133) galactokinase 2
Horse(100070040) galactokinase 2
dog(487548) galactokinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001556 Rosetta Predictions human pricing
NM_002044 Rosetta Predictions human pricing
NM_001013919 Rosetta Predictions rat pricing
NM_175154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085063 predicted 1587
2 SASI_Hs01_00085064 predicted 492
3 SASI_Hs01_00085065 predicted 520
4 SASI_Hs01_00085066 predicted 1496
5 SASI_Hs01_00085067 predicted 463
6 SASI_Hs01_00085068 predicted 547
7 SASI_Hs01_00085069 predicted 458
8 SASI_Hs01_00085070 predicted 1165
9 SASI_Hs01_00085071 predicted 1652
10 SASI_Hs01_00085072 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062075 predicted 1493
2 SASI_Hs01_00062076 predicted 408
3 SASI_Hs01_00062077 predicted 429
4 SASI_Hs01_00062078 predicted 1412
5 SASI_Hs01_00062079 predicted 371
6 SASI_Hs01_00062080 predicted 463
7 SASI_Hs01_00062081 predicted 369
8 SASI_Hs01_00062082 predicted 1075
9 SASI_Hs01_00062083 predicted 1565
10 SASI_Hs01_00062084 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067120 predicted 345
2 SASI_Rn02_00201207 predicted 858
3 SASI_Rn01_00067121 predicted 356
4 SASI_Rn01_00067122 predicted 414
5 SASI_Rn02_00201208 predicted 1472
6 SASI_Rn01_00067123 predicted 1130
7 SASI_Rn01_00067124 predicted 1012
8 SASI_Rn01_00067125 predicted 1549
9 SASI_Rn01_00067126 predicted 1459
10 SASI_Rn01_00067127 predicted 407
11 SASI_Rn01_00067128 predicted 1471
12 SASI_Rn01_00067129 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136994 predicted 1579
2 SASI_Mm01_00136995 predicted 678
3 SASI_Mm01_00136996 predicted 374
4 SASI_Mm02_00345793 predicted 1017
5 SASI_Mm01_00136998 predicted 379
6 SASI_Mm01_00136999 predicted 1418
7 SASI_Mm01_00137000 predicted 445
8 SASI_Mm01_00137001 predicted 425
9 SASI_Mm01_00137002 predicted 276
10 SASI_Mm01_00137003 predicted 418
11 SASI_Mm01_00136997 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002044
VALIDATED
GALK2 MISSION shRNA Bacterial Glycerol Stock
galactokinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-849s1c1
Sequence:CCGGGCGAAGCTCCTGGCTAAATACCTCGAGGTATTTAGCCAGGAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-700s1c1
Sequence:CCGGCTGCCAAGTTGATAGAATTTACTCGAGTAAATTCTATCAACTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2675s1c1
Sequence:CCGGGCTGAAATACTCAGGTAATTGCTCGAGCAATTACCTGAGTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2202s1c1
Sequence:CCGGGCTATCTCCATTACTTAATAGCTCGAGCTATTAAGTAATGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-1581s1c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.2-1419s1c1
Sequence:CCGGCAAAGTTTGTTTGCTACCAAACTCGAGTTTGGTAGCAAACAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-624s1c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-1094s1c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-647s1c1
Sequence:CCGGTCTGAGGGCAACCGATGTAAACTCGAGTTTACATCGGTTGCCCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-722s1c1
Sequence:CCGGGGCAGCAACTTCCCATTTCAACTCGAGTTGAAATGGGAAGTTGCTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.x-1330s1c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-624s21c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1172s21c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1408s21c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002044.2-1581s21c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002044
VALIDATED
GALK2 MISSION shRNA shRNA Plasmid DNA
galactokinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-849s1c1
Sequence:CCGGGCGAAGCTCCTGGCTAAATACCTCGAGGTATTTAGCCAGGAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-700s1c1
Sequence:CCGGCTGCCAAGTTGATAGAATTTACTCGAGTAAATTCTATCAACTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2675s1c1
Sequence:CCGGGCTGAAATACTCAGGTAATTGCTCGAGCAATTACCTGAGTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2202s1c1
Sequence:CCGGGCTATCTCCATTACTTAATAGCTCGAGCTATTAAGTAATGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-1581s1c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.2-1419s1c1
Sequence:CCGGCAAAGTTTGTTTGCTACCAAACTCGAGTTTGGTAGCAAACAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-624s1c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-1094s1c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-647s1c1
Sequence:CCGGTCTGAGGGCAACCGATGTAAACTCGAGTTTACATCGGTTGCCCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-722s1c1
Sequence:CCGGGGCAGCAACTTCCCATTTCAACTCGAGTTGAAATGGGAAGTTGCTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.x-1330s1c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-624s21c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1172s21c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1408s21c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002044.2-1581s21c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002044
VALIDATED
GALK2 MISSION shRNA Lentiviral Transduction Particles
galactokinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-849s1c1
Sequence:CCGGGCGAAGCTCCTGGCTAAATACCTCGAGGTATTTAGCCAGGAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002044.2-700s1c1
Sequence:CCGGCTGCCAAGTTGATAGAATTTACTCGAGTAAATTCTATCAACTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2675s1c1
Sequence:CCGGGCTGAAATACTCAGGTAATTGCTCGAGCAATTACCTGAGTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002044.2-2202s1c1
Sequence:CCGGGCTATCTCCATTACTTAATAGCTCGAGCTATTAAGTAATGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-1581s1c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.2-1419s1c1
Sequence:CCGGCAAAGTTTGTTTGCTACCAAACTCGAGTTTGGTAGCAAACAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.2-624s1c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-1094s1c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-647s1c1
Sequence:CCGGTCTGAGGGCAACCGATGTAAACTCGAGTTTACATCGGTTGCCCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002044.x-722s1c1
Sequence:CCGGGGCAGCAACTTCCCATTTCAACTCGAGTTGAAATGGGAAGTTGCTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002044.x-1330s1c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-624s21c1
Sequence:CCGGGCCAAGAGTGAGCGTTACATTCTCGAGAATGTAACGCTCACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1172s21c1
Sequence:CCGGGCTGCTGGGAGAGTTGATGAACTCGAGTTCATCAACTCTCCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002044.2-1408s21c1
Sequence:CCGGCACCGGAGAAGCAAAGTTTGTCTCGAGACAAACTTTGCTTCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002044.2-1581s21c1
Sequence:CCGGCGGTTGCTATTATATCAAGATCTCGAGATCTTGATATAATAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175154
VALIDATED
GALK2 MISSION shRNA Bacterial Glycerol Stock
galactokinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-254s1c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-1427s1c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175154.2-607s1c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-489s1c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-385s1c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175154.2-607s21c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-254s21c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-385s21c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-489s21c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-1427s21c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175154
VALIDATED
GALK2 MISSION shRNA shRNA Plasmid DNA
galactokinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-254s1c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-1427s1c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175154.2-607s1c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-489s1c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-385s1c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175154.2-607s21c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-254s21c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-385s21c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-489s21c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-1427s21c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175154
VALIDATED
GALK2 MISSION shRNA Lentiviral Transduction Particles
galactokinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-254s1c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-1427s1c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175154.2-607s1c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-489s1c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175154.2-385s1c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175154.2-607s21c1
Sequence:CCGGCCAAGGTGGAACTTGCAGAAACTCGAGTTTCTGCAAGTTCCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-254s21c1
Sequence:CCGGGCACATAGATTACTGTGGATACTCGAGTATCCACAGTAATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-385s21c1
Sequence:CCGGCTACAGCTAATAACATCTGTACTCGAGTACAGATGTTATTAGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-489s21c1
Sequence:CCGGCCTGGAATGAATTGCCTGGTACTCGAGTACCAGGCAATTCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175154.2-1427s21c1
Sequence:CCGGGCATAGCTTGTTTGCCACCAACTCGAGTTGGTGGCAAACAAGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks