EMAIL THIS PAGE TO A FRIEND

GALM

galactose mutarotase (aldose 1-epimerase)

62 Gene Product Result for
Synonyms: IBD1
UniProtKB ID: Q96C23, Q53RY1, Q8NIA2
Gene ID:
Human(130589) Summary: This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose.[provided by RefSeq, Mar 2009]
Mouse(319625) galactose mutarotase
Rat(313843) galactose mutarotase (aldose 1-epimerase)
Zebrafish(436646) galactose mutarotase
chicken(426268) galactose mutarotase (aldose 1-epimerase)
cow(616676) galactose mutarotase (aldose 1-epimerase)
domestic cat(101097231) galactose mutarotase (aldose 1-epimerase)
dog(483039) galactose mutarotase (aldose 1-epimerase)
sheep(101119196) galactose mutarotase (aldose 1-epimerase)
Domestic Rabbit(100338306) galactose mutarotase (aldose 1-epimerase)
naked mole-rat(101702820) galactose mutarotase (aldose 1-epimerase)
domestic guinea pig(100713759) galactose mutarotase (aldose 1-epimerase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039471 MISSION® esiRNA esiRNA targeting mouse Galm (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138801 Rosetta Predictions human pricing
NM_001007704 Rosetta Predictions rat pricing
NM_176963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184186 predicted 657
2 SASI_Hs01_00184187 predicted 1220
3 SASI_Hs01_00184188 predicted 1204
4 SASI_Hs01_00184189 predicted 571
5 SASI_Hs01_00184190 predicted 1223
6 SASI_Hs01_00184191 predicted 351
7 SASI_Hs01_00184192 predicted 1173
8 SASI_Hs01_00184193 predicted 1340
9 SASI_Hs01_00184194 predicted 1220
10 SASI_Hs01_00184195 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198869 predicted 740
2 SASI_Rn02_00198870 predicted 1055
3 SASI_Rn02_00198871 predicted 1176
4 SASI_Rn02_00198872 predicted 341
5 SASI_Rn02_00198873 predicted 752
6 SASI_Rn02_00198874 predicted 1147
7 SASI_Rn02_00198875 predicted 762
8 SASI_Rn02_00198876 predicted 644
9 SASI_Rn02_00198877 predicted 1070
10 SASI_Rn02_00198878 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051146 predicted 1084
2 SASI_Mm01_00051147 predicted 1326
3 SASI_Mm02_00346866 predicted 760
4 SASI_Mm01_00051148 predicted 827
5 SASI_Mm01_00051149 predicted 1344
6 SASI_Mm01_00051151 predicted 296
7 SASI_Mm02_00346867 predicted 1320
8 SASI_Mm01_00051153 predicted 1236
9 SASI_Mm01_00051154 predicted 929
10 SASI_Mm02_00346868 predicted 870
11 SASI_Mm01_00051150 predicted 495
12 SASI_Mm01_00051152 predicted 507
13 SASI_Mm01_00051155 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138801
VALIDATED
GALM MISSION shRNA Bacterial Glycerol Stock
galactose mutarotase (aldose 1-epimerase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1144s21c1
Sequence:CCGGTATCCCAAGCACTCCGGTTTCCTCGAGGAAACCGGAGTGCTTGGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1277s21c1
Sequence:CCGGCTTAAGGAAGTGTGAAGATATCTCGAGATATCTTCACACTTCCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-273s1c1
Sequence:CCGGCCATACTTTGGAGCAGTTATTCTCGAGAATAACTGCTCCAAAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-672s1c1
Sequence:CCGGCCTGTGGATGAAACCCTGATTCTCGAGAATCAGGGTTTCATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-916s1c1
Sequence:CCGGACTTCCTGGATGGCACATTAACTCGAGTTAATGTGCCATCCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-796s1c1
Sequence:CCGGACAATTTCTGTCTGAAGGGATCTCGAGATCCCTTCAGACAGAAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-646s1c1
Sequence:CCGGTCACCATAGAAGCGGATACTTCTCGAGAAGTATCCGCTTCTATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138801
VALIDATED
GALM MISSION shRNA shRNA Plasmid DNA
galactose mutarotase (aldose 1-epimerase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1144s21c1
Sequence:CCGGTATCCCAAGCACTCCGGTTTCCTCGAGGAAACCGGAGTGCTTGGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1277s21c1
Sequence:CCGGCTTAAGGAAGTGTGAAGATATCTCGAGATATCTTCACACTTCCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-273s1c1
Sequence:CCGGCCATACTTTGGAGCAGTTATTCTCGAGAATAACTGCTCCAAAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-672s1c1
Sequence:CCGGCCTGTGGATGAAACCCTGATTCTCGAGAATCAGGGTTTCATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-916s1c1
Sequence:CCGGACTTCCTGGATGGCACATTAACTCGAGTTAATGTGCCATCCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-796s1c1
Sequence:CCGGACAATTTCTGTCTGAAGGGATCTCGAGATCCCTTCAGACAGAAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-646s1c1
Sequence:CCGGTCACCATAGAAGCGGATACTTCTCGAGAAGTATCCGCTTCTATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138801
VALIDATED
GALM MISSION shRNA Lentiviral Transduction Particles
galactose mutarotase (aldose 1-epimerase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1144s21c1
Sequence:CCGGTATCCCAAGCACTCCGGTTTCCTCGAGGAAACCGGAGTGCTTGGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138801.2-1277s21c1
Sequence:CCGGCTTAAGGAAGTGTGAAGATATCTCGAGATATCTTCACACTTCCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-273s1c1
Sequence:CCGGCCATACTTTGGAGCAGTTATTCTCGAGAATAACTGCTCCAAAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-672s1c1
Sequence:CCGGCCTGTGGATGAAACCCTGATTCTCGAGAATCAGGGTTTCATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-916s1c1
Sequence:CCGGACTTCCTGGATGGCACATTAACTCGAGTTAATGTGCCATCCAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-796s1c1
Sequence:CCGGACAATTTCTGTCTGAAGGGATCTCGAGATCCCTTCAGACAGAAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138801.1-646s1c1
Sequence:CCGGTCACCATAGAAGCGGATACTTCTCGAGAAGTATCCGCTTCTATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176963
GALM MISSION shRNA Bacterial Glycerol Stock
galactose mutarotase (aldose 1-epimerase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176963.4-1350s1c1
Sequence:CCGGGATCGTAGCAGCCATAATAATCTCGAGATTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-411s21c1
Sequence:CCGGGTGCTTGGCTTTGCGGAATTGCTCGAGCAATTCCGCAAAGCCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-495s21c1
Sequence:CCGGGCCAAAGGAAGATTCACTATACTCGAGTATAGTGAATCTTCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-525s21c1
Sequence:CCGGGAGTACCACCTGCCAGTTAACCTCGAGGTTAACTGGCAGGTGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176963.4-1349s21c1
Sequence:CCGGAGATCGTAGCAGCCATAATAACTCGAGTTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-830s21c1
Sequence:CCGGCATTGCAGCAGATGCATATTTCTCGAGAAATATGCATCTGCTGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-675s1c1
Sequence:CCGGGCTGAAAGTCTGGGTGACATACTCGAGTATGTCACCCAGACTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-972s1c1
Sequence:CCGGCGACCATAATTTCTGTCTGAACTCGAGTTCAGACAGAAATTATGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-754s1c1
Sequence:CCGGCCAGTTAATCTGACCAACCATCTCGAGATGGTTGGTCAGATTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176963
GALM MISSION shRNA shRNA Plasmid DNA
galactose mutarotase (aldose 1-epimerase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176963.4-1350s1c1
Sequence:CCGGGATCGTAGCAGCCATAATAATCTCGAGATTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-411s21c1
Sequence:CCGGGTGCTTGGCTTTGCGGAATTGCTCGAGCAATTCCGCAAAGCCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-495s21c1
Sequence:CCGGGCCAAAGGAAGATTCACTATACTCGAGTATAGTGAATCTTCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-525s21c1
Sequence:CCGGGAGTACCACCTGCCAGTTAACCTCGAGGTTAACTGGCAGGTGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176963.4-1349s21c1
Sequence:CCGGAGATCGTAGCAGCCATAATAACTCGAGTTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-830s21c1
Sequence:CCGGCATTGCAGCAGATGCATATTTCTCGAGAAATATGCATCTGCTGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-675s1c1
Sequence:CCGGGCTGAAAGTCTGGGTGACATACTCGAGTATGTCACCCAGACTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-972s1c1
Sequence:CCGGCGACCATAATTTCTGTCTGAACTCGAGTTCAGACAGAAATTATGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-754s1c1
Sequence:CCGGCCAGTTAATCTGACCAACCATCTCGAGATGGTTGGTCAGATTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176963
GALM MISSION shRNA Lentiviral Transduction Particles
galactose mutarotase (aldose 1-epimerase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176963.4-1350s1c1
Sequence:CCGGGATCGTAGCAGCCATAATAATCTCGAGATTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-411s21c1
Sequence:CCGGGTGCTTGGCTTTGCGGAATTGCTCGAGCAATTCCGCAAAGCCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-495s21c1
Sequence:CCGGGCCAAAGGAAGATTCACTATACTCGAGTATAGTGAATCTTCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-525s21c1
Sequence:CCGGGAGTACCACCTGCCAGTTAACCTCGAGGTTAACTGGCAGGTGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176963.4-1349s21c1
Sequence:CCGGAGATCGTAGCAGCCATAATAACTCGAGTTATTATGGCTGCTACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176963.4-830s21c1
Sequence:CCGGCATTGCAGCAGATGCATATTTCTCGAGAAATATGCATCTGCTGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-675s1c1
Sequence:CCGGGCTGAAAGTCTGGGTGACATACTCGAGTATGTCACCCAGACTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-972s1c1
Sequence:CCGGCGACCATAATTTCTGTCTGAACTCGAGTTCAGACAGAAATTATGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176963.2-754s1c1
Sequence:CCGGCCAGTTAATCTGACCAACCATCTCGAGATGGTTGGTCAGATTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)