EMAIL THIS PAGE TO A FRIEND

GALNT10

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)

69 Gene Product Result for
Synonyms: GALNACT10 PPGALNACT10 PPGANTASE10
Gene ID:
Human(55568) Summary: This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
Mouse(171212) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10
Rat(170501) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Zebrafish(767665) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
cow(787200) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Horse(100071405) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
dog(489165) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
chicken(416260) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
domestic cat(101097132) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
domestic guinea pig(100728439) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
naked mole-rat(101722354) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
sheep(101109536) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Domestic Rabbit(100349389) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058511 MISSION® esiRNA esiRNA targeting mouse Galnt10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017540 Rosetta Predictions human pricing
NM_198321 Rosetta Predictions human pricing
NM_130742 Rosetta Predictions rat pricing
NM_134189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127777 predicted 564
2 SASI_Hs02_00350165 predicted 1308
3 SASI_Hs01_00127778 predicted 1529
4 SASI_Hs01_00127779 predicted 1445
5 SASI_Hs01_00127780 predicted 1185
6 SASI_Hs01_00127781 predicted 961
7 SASI_Hs01_00127782 predicted 894
8 SASI_Hs01_00127784 predicted 1036
9 SASI_Hs01_00127785 predicted 1024
10 SASI_Hs01_00127786 predicted 1470
11 SASI_Hs01_00127783 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055482 predicted 1424
2 SASI_Hs02_00371875 predicted 2173
3 SASI_Hs01_00055483 predicted 2390
4 SASI_Hs01_00055484 predicted 2312
5 SASI_Hs01_00055485 predicted 2048
6 SASI_Hs01_00055486 predicted 1826
7 SASI_Hs01_00055487 predicted 1764
8 SASI_Hs01_00055489 predicted 1902
9 SASI_Hs01_00055490 predicted 1888
10 SASI_Hs01_00055491 predicted 2333
11 SASI_Hs01_00055488 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054909 predicted 856
2 SASI_Rn01_00054910 predicted 1116
3 SASI_Rn01_00054911 predicted 216
4 SASI_Rn02_00267474 predicted 930
5 SASI_Rn01_00054912 predicted 328
6 SASI_Rn01_00054913 predicted 1222
7 SASI_Rn01_00054914 predicted 341
8 SASI_Rn01_00054915 predicted 405
9 SASI_Rn01_00054916 predicted 1033
10 SASI_Rn01_00054917 predicted 804
11 SASI_Rn01_00054908 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155263 predicted 447
2 SASI_Mm01_00155264 predicted 1603
3 SASI_Mm01_00155265 predicted 801
4 SASI_Mm01_00155266 predicted 270
5 SASI_Mm01_00155267 predicted 333
6 SASI_Mm02_00339470 predicted 600
7 SASI_Mm01_00155268 predicted 450
8 SASI_Mm01_00155269 predicted 1153
9 SASI_Mm01_00155270 predicted 741
10 SASI_Mm01_00155271 predicted 1901
11 SASI_Mm01_00155272 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017540
VALIDATED
GALNT10 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-554s1c1
Sequence:CCGGGCTCCCTTAACTGCAAGAGTTCTCGAGAACTCTTGCAGTTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017540.3-968s1c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-566s1c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-384s1c1
Sequence:CCGGCTACAGGAAGTATGTGCCCTACTCGAGTAGGGCACATACTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-822s1c1
Sequence:CCGGGCACACCAAGAAGTTCTGCTTCTCGAGAAGCAGAACTTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-760s21c1
Sequence:CCGGTGGAACAACATGCAGGTATTCCTCGAGGAATACCTGCATGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-467s21c1
Sequence:CCGGATGAGTACGCAGAGTACATTTCTCGAGAAATGTACTCTGCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-968s21c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-566s21c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017540.3-1160s21c1
Sequence:CCGGCCTGTGGGCACTAGGTGTAAACTCGAGTTTACACCTAGTGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017540
VALIDATED
GALNT10 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-554s1c1
Sequence:CCGGGCTCCCTTAACTGCAAGAGTTCTCGAGAACTCTTGCAGTTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017540.3-968s1c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-566s1c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-384s1c1
Sequence:CCGGCTACAGGAAGTATGTGCCCTACTCGAGTAGGGCACATACTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-822s1c1
Sequence:CCGGGCACACCAAGAAGTTCTGCTTCTCGAGAAGCAGAACTTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-760s21c1
Sequence:CCGGTGGAACAACATGCAGGTATTCCTCGAGGAATACCTGCATGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-467s21c1
Sequence:CCGGATGAGTACGCAGAGTACATTTCTCGAGAAATGTACTCTGCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-968s21c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-566s21c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017540.3-1160s21c1
Sequence:CCGGCCTGTGGGCACTAGGTGTAAACTCGAGTTTACACCTAGTGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017540
VALIDATED
GALNT10 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-554s1c1
Sequence:CCGGGCTCCCTTAACTGCAAGAGTTCTCGAGAACTCTTGCAGTTAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017540.3-968s1c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-566s1c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-384s1c1
Sequence:CCGGCTACAGGAAGTATGTGCCCTACTCGAGTAGGGCACATACTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017540.3-822s1c1
Sequence:CCGGGCACACCAAGAAGTTCTGCTTCTCGAGAAGCAGAACTTCTTGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-760s21c1
Sequence:CCGGTGGAACAACATGCAGGTATTCCTCGAGGAATACCTGCATGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017540.3-467s21c1
Sequence:CCGGATGAGTACGCAGAGTACATTTCTCGAGAAATGTACTCTGCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-968s21c1
Sequence:CCGGGCAGTGAAAGTGACCATAGGACTCGAGTCCTATGGTCACTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017540.3-566s21c1
Sequence:CCGGGCAAGAGTTTCAAGTGGTTTACTCGAGTAAACCACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017540.3-1160s21c1
Sequence:CCGGCCTGTGGGCACTAGGTGTAAACTCGAGTTTACACCTAGTGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134189
GALNT10 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134189.2-3656s1c1
Sequence:CCGGCCCGATTCATTCCATCCTCATCTCGAGATGAGGATGGAATGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1663s1c1
Sequence:CCGGCCTCAGCACACCAAGAAGTTTCTCGAGAAACTTCTTGGTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-513s1c1
Sequence:CCGGCCCAAACTGTAACAGCAAGCTCTCGAGAGCTTGCTGTTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-327s1c1
Sequence:CCGGGCTGAAGGACTGGCATAACAACTCGAGTTGTTATGCCAGTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1308s1c1
Sequence:CCGGGATGGATGAATACGCAGAATACTCGAGTATTCTGCGTATTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134189
GALNT10 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134189.2-3656s1c1
Sequence:CCGGCCCGATTCATTCCATCCTCATCTCGAGATGAGGATGGAATGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1663s1c1
Sequence:CCGGCCTCAGCACACCAAGAAGTTTCTCGAGAAACTTCTTGGTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-513s1c1
Sequence:CCGGCCCAAACTGTAACAGCAAGCTCTCGAGAGCTTGCTGTTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-327s1c1
Sequence:CCGGGCTGAAGGACTGGCATAACAACTCGAGTTGTTATGCCAGTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1308s1c1
Sequence:CCGGGATGGATGAATACGCAGAATACTCGAGTATTCTGCGTATTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134189
GALNT10 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134189.2-3656s1c1
Sequence:CCGGCCCGATTCATTCCATCCTCATCTCGAGATGAGGATGGAATGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1663s1c1
Sequence:CCGGCCTCAGCACACCAAGAAGTTTCTCGAGAAACTTCTTGGTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-513s1c1
Sequence:CCGGCCCAAACTGTAACAGCAAGCTCTCGAGAGCTTGCTGTTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-327s1c1
Sequence:CCGGGCTGAAGGACTGGCATAACAACTCGAGTTGTTATGCCAGTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134189.2-1308s1c1
Sequence:CCGGGATGGATGAATACGCAGAATACTCGAGTATTCTGCGTATTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks