EMAIL THIS PAGE TO A FRIEND

GALNT11

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)

59 Gene Product Result for
Synonyms: GALNACT11
UniProtKB ID: Q8NCW6, Q6PCD1, Q9H6C2, Q9H6Z5, Q9UDR8
Gene ID:
Mouse(231050) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11
Rat(311952) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
sheep(101105153) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Domestic Rabbit(100349001) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
naked mole-rat(101721666) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
domestic guinea pig(100716450) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Zebrafish(558716) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
cow(534904) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Horse(100063633) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
domestic cat(101083669) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
dog(482809) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
chicken(420436) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022087 Rosetta Predictions human pricing
NM_199393 Rosetta Predictions rat pricing
NM_144908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058691 predicted 682
2 SASI_Hs01_00058692 predicted 563
3 SASI_Hs01_00058693 predicted 459
4 SASI_Hs01_00058694 predicted 1773
5 SASI_Hs01_00058695 predicted 496
6 SASI_Hs01_00058696 predicted 1422
7 SASI_Hs01_00058697 predicted 1551
8 SASI_Hs01_00058699 predicted 1188
9 SASI_Hs01_00058700 predicted 827
10 SASI_Hs02_00355467 predicted 1936
11 SASI_Hs01_00058698 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032481 predicted 1454
2 SASI_Rn02_00270216 predicted 926
3 SASI_Rn01_00032482 predicted 365
4 SASI_Rn01_00032483 predicted 396
5 SASI_Rn01_00032484 predicted 1175
6 SASI_Rn01_00032485 predicted 1137
7 SASI_Rn01_00032486 predicted 1212
8 SASI_Rn01_00032487 predicted 1145
9 SASI_Rn01_00032488 predicted 1422
10 SASI_Rn01_00032489 predicted 767
11 SASI_Rn01_00032490 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096357 predicted 390
2 SASI_Mm01_00096358 predicted 417
3 SASI_Mm01_00096359 predicted 401
4 SASI_Mm01_00096360 predicted 1201
5 SASI_Mm01_00096361 predicted 1417
6 SASI_Mm01_00096362 predicted 749
7 SASI_Mm01_00096363 predicted 1237
8 SASI_Mm01_00096364 predicted 1177
9 SASI_Mm02_00340380 predicted 375
10 SASI_Mm01_00096366 predicted 2021
11 SASI_Mm01_00096365 predicted 1494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022087
VALIDATED
GALNT11 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-462s21c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1778s21c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1348s21c1
Sequence:CCGGGCTCTAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-434s21c1
Sequence:CCGGGCCACAGTTCAAAGCAAACAACTCGAGTTGTTTGCTTTGAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1513s1c1
Sequence:CCGGCCAAAGTCCTTCAACGTGGAACTCGAGTTCCACGTTGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1631s1c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-315s1c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022087
VALIDATED
GALNT11 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-462s21c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1778s21c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1348s21c1
Sequence:CCGGGCTCTAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-434s21c1
Sequence:CCGGGCCACAGTTCAAAGCAAACAACTCGAGTTGTTTGCTTTGAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1513s1c1
Sequence:CCGGCCAAAGTCCTTCAACGTGGAACTCGAGTTCCACGTTGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1631s1c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-315s1c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022087
VALIDATED
GALNT11 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-462s21c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1778s21c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-1348s21c1
Sequence:CCGGGCTCTAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022087.2-434s21c1
Sequence:CCGGGCCACAGTTCAAAGCAAACAACTCGAGTTGTTTGCTTTGAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1513s1c1
Sequence:CCGGCCAAAGTCCTTCAACGTGGAACTCGAGTTCCACGTTGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-1631s1c1
Sequence:CCGGCCCAAATCAGATCTGGATCTACTCGAGTAGATCCAGATCTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022087.1-315s1c1
Sequence:CCGGGATGTGATAGACAGTCGTGTTCTCGAGAACACGACTGTCTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144908
GALNT11 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144908.1-2056s1c1
Sequence:CCGGGCCATAAATCAAGGTGCTTTACTCGAGTAAAGCACCTTGATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1296s1c1
Sequence:CCGGGCTCAAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-526s1c1
Sequence:CCGGGCACGCCTTTAATATGCTCATCTCGAGATGAGCATATTAAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1912s1c1
Sequence:CCGGCCTGAGAGTTATGGACCTGATCTCGAGATCAGGTCCATAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-462s1c1
Sequence:CCGGCCTCTGAACTAGGTATGATTTCTCGAGAAATCATACCTAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144908
GALNT11 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144908.1-2056s1c1
Sequence:CCGGGCCATAAATCAAGGTGCTTTACTCGAGTAAAGCACCTTGATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1296s1c1
Sequence:CCGGGCTCAAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-526s1c1
Sequence:CCGGGCACGCCTTTAATATGCTCATCTCGAGATGAGCATATTAAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1912s1c1
Sequence:CCGGCCTGAGAGTTATGGACCTGATCTCGAGATCAGGTCCATAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-462s1c1
Sequence:CCGGCCTCTGAACTAGGTATGATTTCTCGAGAAATCATACCTAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144908
GALNT11 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144908.1-2056s1c1
Sequence:CCGGGCCATAAATCAAGGTGCTTTACTCGAGTAAAGCACCTTGATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1296s1c1
Sequence:CCGGGCTCAAGAGTAGGACACATTTCTCGAGAAATGTGTCCTACTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-526s1c1
Sequence:CCGGGCACGCCTTTAATATGCTCATCTCGAGATGAGCATATTAAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-1912s1c1
Sequence:CCGGCCTGAGAGTTATGGACCTGATCTCGAGATCAGGTCCATAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144908.1-462s1c1
Sequence:CCGGCCTCTGAACTAGGTATGATTTCTCGAGAAATCATACCTAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks