EMAIL THIS PAGE TO A FRIEND

GALNT12

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)

106 Gene Product Result for
Synonyms: CRCS1 GalNAc-T12
UniProtKB ID: Q8IXK2, Q5TCF7, Q8NG54, Q96CT9, Q9H771
Gene ID:
Human(79695) Summary: This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Mouse(230145) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12
Rat(313233) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Zebrafish(559736) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12
cow(508488) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Horse(100063861) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
domestic cat(101093556) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
dog(474777) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
chicken(420978) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
domestic guinea pig(100714400) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
naked mole-rat(101718774) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
sheep(101103047) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Domestic Rabbit(100346333) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024642 Rosetta Predictions human pricing
XM_001066416 Rosetta Predictions rat pricing
XM_232988 Rosetta Predictions rat pricing
NM_172693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357027 predicted 1669
2 SASI_Hs01_00114112 predicted 499
3 SASI_Hs02_00357028 predicted 1703
4 SASI_Hs02_00357029 predicted 1531
5 SASI_Hs01_00114114 predicted 899
6 SASI_Hs01_00114117 predicted 1258
7 SASI_Hs01_00114118 predicted 1377
8 SASI_Hs01_00114119 predicted 482
9 SASI_Hs01_00114120 predicted 395
10 SASI_Hs02_00357030 predicted 1735
11 SASI_Hs01_00114113 predicted 946
12 SASI_Hs01_00114115 predicted 941
13 SASI_Hs01_00114116 predicted 1071
14 SASI_Hs01_00114121 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317391 predicted 1205
2 SASI_Rn02_00317392 predicted 343
3 SASI_Rn02_00317393 predicted 1735
4 SASI_Rn02_00317394 predicted 1838
5 SASI_Rn02_00317395 predicted 1375
6 SASI_Rn02_00317396 predicted 952
7 SASI_Rn02_00317397 predicted 504
8 SASI_Rn02_00317398 predicted 957
9 SASI_Rn02_00317399 predicted 455
10 SASI_Rn02_00317400 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387364 predicted 1193
2 SASI_Rn02_00387365 predicted 337
3 SASI_Rn02_00387366 predicted 1700
4 SASI_Rn02_00387367 predicted 1805
5 SASI_Rn02_00387368 predicted 1366
6 SASI_Rn02_00387369 predicted 942
7 SASI_Rn02_00387370 predicted 494
8 SASI_Rn02_00387371 predicted 945
9 SASI_Rn02_00387372 predicted 443
10 SASI_Rn02_00387373 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106887 predicted 1241
2 SASI_Mm02_00344439 predicted 515
3 SASI_Mm01_00106888 predicted 409
4 SASI_Mm01_00106889 predicted 1694
5 SASI_Mm01_00106890 predicted 398
6 SASI_Mm01_00106891 predicted 1181
7 SASI_Mm01_00106892 predicted 1362
8 SASI_Mm01_00106893 predicted 909
9 SASI_Mm01_00106894 predicted 308
10 SASI_Mm01_00106895 predicted 1663
11 SASI_Mm01_00106896 predicted 1850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024642
VALIDATED
GALNT12 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-406s1c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-297s1c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-1475s1c1
Sequence:CCGGCCCAGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-460s1c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-460s21c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-406s21c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-297s21c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-1366s21c1
Sequence:CCGGGACTACTGCTTTGACTATAACCTCGAGGTTATAGTCAAAGCAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-2154s21c1
Sequence:CCGGAGGTTCAAGCAACGTACTTTGCTCGAGCAAAGTACGTTGCTTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024642
VALIDATED
GALNT12 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-406s1c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-297s1c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-1475s1c1
Sequence:CCGGCCCAGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-460s1c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-460s21c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-406s21c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-297s21c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-1366s21c1
Sequence:CCGGGACTACTGCTTTGACTATAACCTCGAGGTTATAGTCAAAGCAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-2154s21c1
Sequence:CCGGAGGTTCAAGCAACGTACTTTGCTCGAGCAAAGTACGTTGCTTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024642
VALIDATED
GALNT12 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-406s1c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-297s1c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-1475s1c1
Sequence:CCGGCCCAGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024642.2-460s1c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-460s21c1
Sequence:CCGGCGGACAGTTTACAGTGTCCTTCTCGAGAAGGACACTGTAAACTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-406s21c1
Sequence:CCGGCCCAGGACATCTGTTATCATACTCGAGTATGATAACAGATGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-297s21c1
Sequence:CCGGGCTGCACCAGATTAACATCTACTCGAGTAGATGTTAATCTGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-1366s21c1
Sequence:CCGGGACTACTGCTTTGACTATAACCTCGAGGTTATAGTCAAAGCAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024642.3-2154s21c1
Sequence:CCGGAGGTTCAAGCAACGTACTTTGCTCGAGCAAAGTACGTTGCTTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172693
GALNT12 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1481s1c1
Sequence:CCGGCCCGGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-396s1c1
Sequence:CCGGCGATTATGATAACCTGCCCAACTCGAGTTGGGCAGGTTATCATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-306s1c1
Sequence:CCGGGCACCAGATCAACATCTATCTCTCGAGAGATAGATGTTGATCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1183s1c1
Sequence:CCGGGAACTCTACTACCACCGCAATCTCGAGATTGCGGTGGTAGTAGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-1372s21c1
Sequence:CCGGGGTACTGCCTTGACTACAATCCTCGAGGATTGTAGTCAAGGCAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-536s21c1
Sequence:CCGGCAGCGACAGAGAGCACCTAAACTCGAGTTTAGGTGCTCTCTGTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-950s21c1
Sequence:CCGGTGCTGTGAGTAAGAGATATTTCTCGAGAAATATCTCTTACTCACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172693.3-1814s21c1
Sequence:CCGGCAGCGTACACGGTTGTCATTCCTCGAGGAATGACAACCGTGTACGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172693
GALNT12 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1481s1c1
Sequence:CCGGCCCGGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-396s1c1
Sequence:CCGGCGATTATGATAACCTGCCCAACTCGAGTTGGGCAGGTTATCATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-306s1c1
Sequence:CCGGGCACCAGATCAACATCTATCTCTCGAGAGATAGATGTTGATCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1183s1c1
Sequence:CCGGGAACTCTACTACCACCGCAATCTCGAGATTGCGGTGGTAGTAGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-1372s21c1
Sequence:CCGGGGTACTGCCTTGACTACAATCCTCGAGGATTGTAGTCAAGGCAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-536s21c1
Sequence:CCGGCAGCGACAGAGAGCACCTAAACTCGAGTTTAGGTGCTCTCTGTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-950s21c1
Sequence:CCGGTGCTGTGAGTAAGAGATATTTCTCGAGAAATATCTCTTACTCACAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172693.3-1814s21c1
Sequence:CCGGCAGCGTACACGGTTGTCATTCCTCGAGGAATGACAACCGTGTACGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172693
GALNT12 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1481s1c1
Sequence:CCGGCCCGGAAAGAAATACGCTATACTCGAGTATAGCGTATTTCTTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-396s1c1
Sequence:CCGGCGATTATGATAACCTGCCCAACTCGAGTTGGGCAGGTTATCATAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-306s1c1
Sequence:CCGGGCACCAGATCAACATCTATCTCTCGAGAGATAGATGTTGATCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172693.2-1183s1c1
Sequence:CCGGGAACTCTACTACCACCGCAATCTCGAGATTGCGGTGGTAGTAGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-1372s21c1
Sequence:CCGGGGTACTGCCTTGACTACAATCCTCGAGGATTGTAGTCAAGGCAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-536s21c1
Sequence:CCGGCAGCGACAGAGAGCACCTAAACTCGAGTTTAGGTGCTCTCTGTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172693.3-950s21c1
Sequence:CCGGTGCTGTGAGTAAGAGATATTTCTCGAGAAATATCTCTTACTCACAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172693.3-1814s21c1
Sequence:CCGGCAGCGTACACGGTTGTCATTCCTCGAGGAATGACAACCGTGTACGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)