EMAIL THIS PAGE TO A FRIEND

GALNT13

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)

47 Gene Product Result for
Synonyms: GalNAc-T13 H_NH0187G20.1 WUGSC:H_NH0187G20.1
UniProtKB ID: Q8IUC8, Q6ZWG1, Q96PX0, Q9UIE5
Gene ID:
Human(114805) Summary: The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
Mouse(271786) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13
Rat(311039) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
domestic guinea pig(100726608) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
naked mole-rat(101719996) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
sheep(101115605) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Zebrafish(100330695) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13
chicken(424319) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
cow(532545) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Horse(100050588) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
domestic cat(101088769) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
dog(478753) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052917 Rosetta Predictions human pricing
NM_199106 Rosetta Predictions rat pricing
NM_173030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063726 predicted 803
2 SASI_Hs01_00063727 predicted 1874
3 SASI_Hs01_00063728 predicted 2165
4 SASI_Hs01_00063729 predicted 2104
5 SASI_Hs01_00063730 predicted 2255
6 SASI_Hs01_00063732 predicted 1842
7 SASI_Hs01_00063733 predicted 1838
8 SASI_Hs02_00361674 predicted 694
9 SASI_Hs02_00361675 predicted 1889
10 SASI_Hs01_00063734 predicted 1481
11 SASI_Hs01_00063731 predicted 1490
12 SASI_Hs01_00063735 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112230 predicted 604
2 SASI_Rn02_00270126 predicted 1496
3 SASI_Rn01_00112233 predicted 1366
4 SASI_Rn02_00270127 predicted 900
5 SASI_Rn01_00112234 predicted 1605
6 SASI_Rn01_00112235 predicted 1012
7 SASI_Rn01_00112236 predicted 1647
8 SASI_Rn01_00112237 predicted 358
9 SASI_Rn01_00112238 predicted 1184
10 SASI_Rn01_00112239 predicted 1374
11 SASI_Rn01_00112231 predicted 1662
12 SASI_Rn01_00112232 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065930 predicted 1018
2 SASI_Mm01_00065931 predicted 936
3 SASI_Mm01_00065932 predicted 1786
4 SASI_Mm01_00065933 predicted 1806
5 SASI_Mm01_00065934 predicted 1789
6 SASI_Mm01_00065935 predicted 508
7 SASI_Mm01_00065936 predicted 1454
8 SASI_Mm01_00065937 predicted 1288
9 SASI_Mm01_00065938 predicted 893
10 SASI_Mm01_00065939 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052917
VALIDATED
GALNT13 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2520s21c1
Sequence:CCGGACTCATGTCATAGGGTTAATTCTCGAGAATTAACCCTATGACATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2100s21c1
Sequence:CCGGACTCACGTTGCGACATGTTAACTCGAGTTAACATGTCGCAACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1488s21c1
Sequence:CCGGTTACGATGCAGGAATGGATATCTCGAGATATCCATTCCTGCATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2030s21c1
Sequence:CCGGATGGACCTGTAATCATGTTAACTCGAGTTAACATGATTACAGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1114s21c1
Sequence:CCGGGAAGAACGCTCTGGGTTAATACTCGAGTATTAACCCAGAGCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2567s21c1
Sequence:CCGGTGGTGATTGAAAGAGATAATGCTCGAGCATTATCTCTTTCAATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2686s21c1
Sequence:CCGGTCTACAACAGGGCCACATATTCTCGAGAATATGTGGCCCTGTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-701s1c1
Sequence:CCGGGCCCTATCATTGATGTGATTACTCGAGTAATCACATCAATGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-187s1c1
Sequence:CCGGGCTGTGTTGATTCCTAAAGATCTCGAGATCTTTAGGAATCAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1641s1c1
Sequence:CCGGGCTGCTAAGGAACATGACCTTCTCGAGAAGGTCATGTTCCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1153s1c1
Sequence:CCGGCCAGGTGTTGTCAAAGTGGATCTCGAGATCCACTTTGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-259s1c1
Sequence:CCGGGCCAGTGATTTGATTGCCCTTCTCGAGAAGGGCAATCAAATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052917
VALIDATED
GALNT13 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2520s21c1
Sequence:CCGGACTCATGTCATAGGGTTAATTCTCGAGAATTAACCCTATGACATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2100s21c1
Sequence:CCGGACTCACGTTGCGACATGTTAACTCGAGTTAACATGTCGCAACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1488s21c1
Sequence:CCGGTTACGATGCAGGAATGGATATCTCGAGATATCCATTCCTGCATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2030s21c1
Sequence:CCGGATGGACCTGTAATCATGTTAACTCGAGTTAACATGATTACAGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1114s21c1
Sequence:CCGGGAAGAACGCTCTGGGTTAATACTCGAGTATTAACCCAGAGCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2567s21c1
Sequence:CCGGTGGTGATTGAAAGAGATAATGCTCGAGCATTATCTCTTTCAATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2686s21c1
Sequence:CCGGTCTACAACAGGGCCACATATTCTCGAGAATATGTGGCCCTGTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-701s1c1
Sequence:CCGGGCCCTATCATTGATGTGATTACTCGAGTAATCACATCAATGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-187s1c1
Sequence:CCGGGCTGTGTTGATTCCTAAAGATCTCGAGATCTTTAGGAATCAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1641s1c1
Sequence:CCGGGCTGCTAAGGAACATGACCTTCTCGAGAAGGTCATGTTCCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1153s1c1
Sequence:CCGGCCAGGTGTTGTCAAAGTGGATCTCGAGATCCACTTTGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-259s1c1
Sequence:CCGGGCCAGTGATTTGATTGCCCTTCTCGAGAAGGGCAATCAAATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052917
VALIDATED
GALNT13 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2520s21c1
Sequence:CCGGACTCATGTCATAGGGTTAATTCTCGAGAATTAACCCTATGACATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2100s21c1
Sequence:CCGGACTCACGTTGCGACATGTTAACTCGAGTTAACATGTCGCAACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1488s21c1
Sequence:CCGGTTACGATGCAGGAATGGATATCTCGAGATATCCATTCCTGCATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-2030s21c1
Sequence:CCGGATGGACCTGTAATCATGTTAACTCGAGTTAACATGATTACAGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052917.2-1114s21c1
Sequence:CCGGGAAGAACGCTCTGGGTTAATACTCGAGTATTAACCCAGAGCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2567s21c1
Sequence:CCGGTGGTGATTGAAAGAGATAATGCTCGAGCATTATCTCTTTCAATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052917.2-2686s21c1
Sequence:CCGGTCTACAACAGGGCCACATATTCTCGAGAATATGTGGCCCTGTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-701s1c1
Sequence:CCGGGCCCTATCATTGATGTGATTACTCGAGTAATCACATCAATGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_052917.1-187s1c1
Sequence:CCGGGCTGTGTTGATTCCTAAAGATCTCGAGATCTTTAGGAATCAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1641s1c1
Sequence:CCGGGCTGCTAAGGAACATGACCTTCTCGAGAAGGTCATGTTCCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-1153s1c1
Sequence:CCGGCCAGGTGTTGTCAAAGTGGATCTCGAGATCCACTTTGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052917.1-259s1c1
Sequence:CCGGGCCAGTGATTTGATTGCCCTTCTCGAGAAGGGCAATCAAATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173030
GALNT13 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173030.2-2469s21c1
Sequence:CCGGCTCTTGTCACAGGGTTATTTGCTCGAGCAAATAACCCTGTGACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173030.2-1823s21c1
Sequence:CCGCGACCAATCAATGCTTAGATAACTCGAGTTATCTAAGCATTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173030.1-2306s1c1
Sequence:CCGGCCCAAGATGTGAAAGTCTCTACTCGAGTAGAGACTTTCACATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1214s1c1
Sequence:CCGGGCCCGATCATTGATGTTATTACTCGAGTAATAACATCAATGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-588s1c1
Sequence:CCGGCCTGTACTTCAGCGAGTGTAACTCGAGTTACACTCGCTGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1986s1c1
Sequence:CCGGCCTCGTATATACGCCAACAATCTCGAGATTGTTGGCGTATATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-2170s1c1
Sequence:CCGGGCTAACAGTAACCAATGTCTTCTCGAGAAGACATTGGTTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173030
GALNT13 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173030.2-2469s21c1
Sequence:CCGGCTCTTGTCACAGGGTTATTTGCTCGAGCAAATAACCCTGTGACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173030.2-1823s21c1
Sequence:CCGCGACCAATCAATGCTTAGATAACTCGAGTTATCTAAGCATTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173030.1-2306s1c1
Sequence:CCGGCCCAAGATGTGAAAGTCTCTACTCGAGTAGAGACTTTCACATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1214s1c1
Sequence:CCGGGCCCGATCATTGATGTTATTACTCGAGTAATAACATCAATGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-588s1c1
Sequence:CCGGCCTGTACTTCAGCGAGTGTAACTCGAGTTACACTCGCTGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1986s1c1
Sequence:CCGGCCTCGTATATACGCCAACAATCTCGAGATTGTTGGCGTATATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-2170s1c1
Sequence:CCGGGCTAACAGTAACCAATGTCTTCTCGAGAAGACATTGGTTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173030
GALNT13 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173030.2-2469s21c1
Sequence:CCGGCTCTTGTCACAGGGTTATTTGCTCGAGCAAATAACCCTGTGACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173030.2-1823s21c1
Sequence:CCGCGACCAATCAATGCTTAGATAACTCGAGTTATCTAAGCATTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173030.1-2306s1c1
Sequence:CCGGCCCAAGATGTGAAAGTCTCTACTCGAGTAGAGACTTTCACATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1214s1c1
Sequence:CCGGGCCCGATCATTGATGTTATTACTCGAGTAATAACATCAATGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-588s1c1
Sequence:CCGGCCTGTACTTCAGCGAGTGTAACTCGAGTTACACTCGCTGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-1986s1c1
Sequence:CCGGCCTCGTATATACGCCAACAATCTCGAGATTGTTGGCGTATATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173030.1-2170s1c1
Sequence:CCGGGCTAACAGTAACCAATGTCTTCTCGAGAAGACATTGGTTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks