EMAIL THIS PAGE TO A FRIEND

GALNT14

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)

92 Gene Product Result for
Synonyms: GALNT15 GalNac-T10 GalNac-T14
Gene ID:
Human(79623) Summary: This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(71685) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14
Rat(313878) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Zebrafish(562739) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
chicken(421305) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
cow(540500) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Horse(100070711) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
domestic cat(101089934) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
dog(483025) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
sheep(101104386) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Domestic Rabbit(100344390) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
naked mole-rat(101706922) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
domestic guinea pig(100730832) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024572 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024572 Rosetta Predictions human pricing
NM_001012109 Rosetta Predictions rat pricing
XM_575992 Rosetta Predictions rat pricing
NM_027864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201917 predicted 675
2 SASI_Hs01_00201918 predicted 1119
3 SASI_Hs01_00201919 predicted 1785
4 SASI_Hs01_00201920 predicted 2205
5 SASI_Hs01_00201921 predicted 1760
6 SASI_Hs01_00201922 predicted 2143
7 SASI_Hs01_00201923 predicted 1122
8 SASI_Hs01_00201924 predicted 1967
9 SASI_Hs01_00201925 predicted 1118
10 SASI_Hs02_00356889 predicted 1962
11 SASI_Hs01_00201926 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083591 predicted 1933
2 SASI_Rn01_00083592 predicted 1072
3 SASI_Rn01_00083593 predicted 501
4 SASI_Rn01_00083595 predicted 418
5 SASI_Rn01_00083596 predicted 1128
6 SASI_Rn02_00200256 predicted 845
7 SASI_Rn01_00083597 predicted 1346
8 SASI_Rn01_00083598 predicted 1804
9 SASI_Rn01_00083599 predicted 830
10 SASI_Rn02_00200257 predicted 908
11 SASI_Rn01_00083590 predicted 618
12 SASI_Rn01_00083594 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184095 predicted 2065
2 SASI_Rn01_00184096 predicted 1610
3 SASI_Rn01_00184097 predicted 1940
4 SASI_Rn01_00184098 predicted 1811
5 SASI_Rn01_00184099 predicted 1638
6 SASI_Rn01_00184100 predicted 1792
7 SASI_Rn01_00184101 predicted 1563
8 SASI_Rn01_00184102 predicted 1998
9 SASI_Rn01_00184103 predicted 1626
10 SASI_Rn01_00184104 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107353 predicted 875
2 SASI_Mm01_00107354 predicted 436
3 SASI_Mm02_00332823 predicted 208
4 SASI_Mm01_00107355 predicted 382
5 SASI_Mm01_00107356 predicted 1197
6 SASI_Mm01_00107357 predicted 1138
7 SASI_Mm01_00107358 predicted 877
8 SASI_Mm01_00107359 predicted 1269
9 SASI_Mm01_00107360 predicted 929
10 SASI_Mm01_00107362 predicted 1149
11 SASI_Mm01_00107361 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027864
GALNT14 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-680s1c1
Sequence:CCGGCCCTGTGATTGACATCATTAACTCGAGTTAATGATGTCAATCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027864.1-1926s1c1
Sequence:CCGGCGATGGGAAGTGTTTGTTGTACTCGAGTACAACAAACACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-180s1c1
Sequence:CCGGCGGCGGTATCTGAATGCCAAACTCGAGTTTGGCATTCAGATACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-485s1c1
Sequence:CCGGGCAACTCATCAAATTGCCCAACTCGAGTTGGGCAATTTGATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-1519s1c1
Sequence:CCGGCCCGAATTGAGCACATAGCATCTCGAGATGCTATGTGCTCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027864
GALNT14 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-680s1c1
Sequence:CCGGCCCTGTGATTGACATCATTAACTCGAGTTAATGATGTCAATCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027864.1-1926s1c1
Sequence:CCGGCGATGGGAAGTGTTTGTTGTACTCGAGTACAACAAACACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-180s1c1
Sequence:CCGGCGGCGGTATCTGAATGCCAAACTCGAGTTTGGCATTCAGATACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-485s1c1
Sequence:CCGGGCAACTCATCAAATTGCCCAACTCGAGTTGGGCAATTTGATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-1519s1c1
Sequence:CCGGCCCGAATTGAGCACATAGCATCTCGAGATGCTATGTGCTCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027864
GALNT14 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-680s1c1
Sequence:CCGGCCCTGTGATTGACATCATTAACTCGAGTTAATGATGTCAATCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027864.1-1926s1c1
Sequence:CCGGCGATGGGAAGTGTTTGTTGTACTCGAGTACAACAAACACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-180s1c1
Sequence:CCGGCGGCGGTATCTGAATGCCAAACTCGAGTTTGGCATTCAGATACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-485s1c1
Sequence:CCGGGCAACTCATCAAATTGCCCAACTCGAGTTGGGCAATTTGATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027864.1-1519s1c1
Sequence:CCGGCCCGAATTGAGCACATAGCATCTCGAGATGCTATGTGCTCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024572
VALIDATED
GALNT14 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024572.1-1286s1c1
Sequence:CCGGCTGGAGAATATCTACCCTGAACTCGAGTTCAGGGTAGATATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-1504s1c1
Sequence:CCGGCCTGTCAGTCATCACCTTGTTCTCGAGAACAAGGTGATGACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-506s1c1
Sequence:CCGGCGGGAAATCATATTAGTGGATCTCGAGATCCACTAATATGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-184s1c1
Sequence:CCGGCCCTAAGGTTTGGTCCTTGTTCTCGAGAACAAGGACCAAACCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-124s1c1
Sequence:CCGGGCTGTTCTTCTGGGTAACCAACTCGAGTTGGTTACCCAGAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2518s21c1
Sequence:CCGGAGTCATTCCCTGATTGGTATCCTCGAGGATACCAATCAGGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1289s21c1
Sequence:CCGGGTGTGCCCTGTGATCGATATCCTCGAGGATATCGATCACAGGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2483s21c1
Sequence:CCGGCATGTTCTCAAGGCCGTTAAGCTCGAGCTTAACGGCCTTGAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1120s21c1
Sequence:CCGGGGTGAAATGCTTGCGCAATAACTCGAGTTATTGCGCAAGCATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024572
VALIDATED
GALNT14 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024572.1-1286s1c1
Sequence:CCGGCTGGAGAATATCTACCCTGAACTCGAGTTCAGGGTAGATATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-1504s1c1
Sequence:CCGGCCTGTCAGTCATCACCTTGTTCTCGAGAACAAGGTGATGACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-506s1c1
Sequence:CCGGCGGGAAATCATATTAGTGGATCTCGAGATCCACTAATATGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-184s1c1
Sequence:CCGGCCCTAAGGTTTGGTCCTTGTTCTCGAGAACAAGGACCAAACCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-124s1c1
Sequence:CCGGGCTGTTCTTCTGGGTAACCAACTCGAGTTGGTTACCCAGAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2518s21c1
Sequence:CCGGAGTCATTCCCTGATTGGTATCCTCGAGGATACCAATCAGGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1289s21c1
Sequence:CCGGGTGTGCCCTGTGATCGATATCCTCGAGGATATCGATCACAGGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2483s21c1
Sequence:CCGGCATGTTCTCAAGGCCGTTAAGCTCGAGCTTAACGGCCTTGAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1120s21c1
Sequence:CCGGGGTGAAATGCTTGCGCAATAACTCGAGTTATTGCGCAAGCATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024572
VALIDATED
GALNT14 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024572.1-1286s1c1
Sequence:CCGGCTGGAGAATATCTACCCTGAACTCGAGTTCAGGGTAGATATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-1504s1c1
Sequence:CCGGCCTGTCAGTCATCACCTTGTTCTCGAGAACAAGGTGATGACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-506s1c1
Sequence:CCGGCGGGAAATCATATTAGTGGATCTCGAGATCCACTAATATGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-184s1c1
Sequence:CCGGCCCTAAGGTTTGGTCCTTGTTCTCGAGAACAAGGACCAAACCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024572.1-124s1c1
Sequence:CCGGGCTGTTCTTCTGGGTAACCAACTCGAGTTGGTTACCCAGAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2518s21c1
Sequence:CCGGAGTCATTCCCTGATTGGTATCCTCGAGGATACCAATCAGGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1289s21c1
Sequence:CCGGGTGTGCCCTGTGATCGATATCCTCGAGGATATCGATCACAGGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024572.2-2483s21c1
Sequence:CCGGCATGTTCTCAAGGCCGTTAAGCTCGAGCTTAACGGCCTTGAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024572.2-1120s21c1
Sequence:CCGGGGTGAAATGCTTGCGCAATAACTCGAGTTATTGCGCAAGCATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks