EMAIL THIS PAGE TO A FRIEND

GALNT15

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15

287 Gene Product Result for
Synonyms: GALNACT15 GALNT13 GALNT7 GALNTL2 PIH5
Gene ID:
Mouse(78754) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Rat(100360475) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
domestic guinea pig(100726167) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
naked mole-rat(101720162) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075941 MISSION® esiRNA esiRNA human GALNTL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054110 Rosetta Predictions human pricing
NM_030166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115599 predicted 2857
2 SASI_Hs01_00115600 predicted 1848
3 SASI_Hs01_00115601 predicted 1417
4 SASI_Hs01_00115602 predicted 2905
5 SASI_Hs02_00361990 predicted 2151
6 SASI_Hs01_00115603 predicted 2902
7 SASI_Hs02_00361991 predicted 2910
8 SASI_Hs01_00115604 predicted 1847
9 SASI_Hs01_00115605 predicted 2856
10 SASI_Hs01_00115608 predicted 1210
11 SASI_Hs01_00115606 predicted 2209
12 SASI_Hs01_00115607 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336568 predicted 1779
2 SASI_Mm02_00336569 predicted 1714
3 SASI_Mm02_00336570 predicted 1675
4 SASI_Mm02_00336571 predicted 1094
5 SASI_Mm02_00336572 predicted 939
6 SASI_Mm02_00336573 predicted 453
7 SASI_Mm02_00336574 predicted 1876
8 SASI_Mm02_00336575 predicted 1330
9 SASI_Mm02_00336576 predicted 1731
10 SASI_Mm02_00336577 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054110
GALNT15 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-1191s21c1
Sequence:CCGGAGTCTGCTCTCAGCGAATATGCTCGAGCATATTCGCTGAGAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-2254s21c1
Sequence:CCGGGATGATTGTCCACATTCTTTCCTCGAGGAAAGAATGTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-2394s1c1
Sequence:CCGGGACCAGATCAATGCTGTGGATCTCGAGATCCACAGCATTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1947s1c1
Sequence:CCGGTGTCGGACATTCCACTGGTTTCTCGAGAAACCAGTGGAATGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1418s1c1
Sequence:CCGGCCGAGTGGTATCTCCGGTGATCTCGAGATCACCGGAGATACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1802s1c1
Sequence:CCGGCCTGAGGAACAGGGTTCGCATCTCGAGATGCGAACCCTGTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-866s1c1
Sequence:CCGGGCAGCCAAGGAGGCAGGATAACTCGAGTTATCCTGCCTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054110
GALNT15 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-1191s21c1
Sequence:CCGGAGTCTGCTCTCAGCGAATATGCTCGAGCATATTCGCTGAGAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-2254s21c1
Sequence:CCGGGATGATTGTCCACATTCTTTCCTCGAGGAAAGAATGTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-2394s1c1
Sequence:CCGGGACCAGATCAATGCTGTGGATCTCGAGATCCACAGCATTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1947s1c1
Sequence:CCGGTGTCGGACATTCCACTGGTTTCTCGAGAAACCAGTGGAATGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1418s1c1
Sequence:CCGGCCGAGTGGTATCTCCGGTGATCTCGAGATCACCGGAGATACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1802s1c1
Sequence:CCGGCCTGAGGAACAGGGTTCGCATCTCGAGATGCGAACCCTGTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-866s1c1
Sequence:CCGGGCAGCCAAGGAGGCAGGATAACTCGAGTTATCCTGCCTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054110
GALNT15 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-1191s21c1
Sequence:CCGGAGTCTGCTCTCAGCGAATATGCTCGAGCATATTCGCTGAGAGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054110.4-2254s21c1
Sequence:CCGGGATGATTGTCCACATTCTTTCCTCGAGGAAAGAATGTGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-2394s1c1
Sequence:CCGGGACCAGATCAATGCTGTGGATCTCGAGATCCACAGCATTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1947s1c1
Sequence:CCGGTGTCGGACATTCCACTGGTTTCTCGAGAAACCAGTGGAATGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1418s1c1
Sequence:CCGGCCGAGTGGTATCTCCGGTGATCTCGAGATCACCGGAGATACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-1802s1c1
Sequence:CCGGCCTGAGGAACAGGGTTCGCATCTCGAGATGCGAACCCTGTTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054110.2-866s1c1
Sequence:CCGGGCAGCCAAGGAGGCAGGATAACTCGAGTTATCCTGCCTCCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030166
GALNT15 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-2350s1c1
Sequence:CCGGCTTGCGTCAATGTGATGGTAACTCGAGTTACCATCACATTGACGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-544s1c1
Sequence:CCGGGCTTCAGTTCCTCCTACTCTTCTCGAGAAGAGTAGGAGGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1507s1c1
Sequence:CCGGGAAGCTGGATTTCCGATGGAACTCGAGTTCCATCGGAAATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1614s1c1
Sequence:CCGGTGGACAGACATTACTTCCAAACTCGAGTTTGGAAGTAATGTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030166.1-3901s1c1
Sequence:CCGGCCGGATTAACACCATCTAATACTCGAGTATTAGATGGTGTTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030166
GALNT15 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-2350s1c1
Sequence:CCGGCTTGCGTCAATGTGATGGTAACTCGAGTTACCATCACATTGACGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-544s1c1
Sequence:CCGGGCTTCAGTTCCTCCTACTCTTCTCGAGAAGAGTAGGAGGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1507s1c1
Sequence:CCGGGAAGCTGGATTTCCGATGGAACTCGAGTTCCATCGGAAATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1614s1c1
Sequence:CCGGTGGACAGACATTACTTCCAAACTCGAGTTTGGAAGTAATGTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030166.1-3901s1c1
Sequence:CCGGCCGGATTAACACCATCTAATACTCGAGTATTAGATGGTGTTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030166
GALNT15 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-2350s1c1
Sequence:CCGGCTTGCGTCAATGTGATGGTAACTCGAGTTACCATCACATTGACGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-544s1c1
Sequence:CCGGGCTTCAGTTCCTCCTACTCTTCTCGAGAAGAGTAGGAGGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1507s1c1
Sequence:CCGGGAAGCTGGATTTCCGATGGAACTCGAGTTCCATCGGAAATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030166.1-1614s1c1
Sequence:CCGGTGGACAGACATTACTTCCAAACTCGAGTTTGGAAGTAATGTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030166.1-3901s1c1
Sequence:CCGGCCGGATTAACACCATCTAATACTCGAGTATTAGATGGTGTTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks