EMAIL THIS PAGE TO A FRIEND

GALNT16

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16

102 Gene Product Result for
Synonyms: GALNACT16 GALNTL1 GalNAc-T16
UniProtKB ID: Q8N428, Q4KMG3, Q9ULT9
Gene ID:
Mouse(108760) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Rat(362760) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
naked mole-rat(101709424) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
domestic guinea pig(100722271) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_031104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_031104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_031104 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020692 Rosetta Predictions human pricing
XM_001053341 Rosetta Predictions rat pricing
XM_001053416 Rosetta Predictions rat pricing
XM_343087 Rosetta Predictions rat pricing
NM_001081421 Rosetta Predictions mouse pricing
XM_283069 Rosetta Predictions mouse pricing
XM_987609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199006 predicted 1758
2 SASI_Hs01_00199007 predicted 1157
3 SASI_Hs01_00199008 predicted 814
4 SASI_Hs01_00199009 predicted 944
5 SASI_Hs01_00199010 predicted 285
6 SASI_Hs01_00199011 predicted 1149
7 SASI_Hs01_00199012 predicted 580
8 SASI_Hs02_00353687 predicted 813
9 SASI_Hs01_00199013 predicted 973
10 SASI_Hs02_00353688 predicted 550
11 SASI_Hs01_00199014 predicted 711
12 SASI_Hs01_00199015 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272007 predicted 1219
2 SASI_Rn02_00272008 predicted 1547
3 SASI_Rn02_00272009 predicted 749
4 SASI_Rn02_00272010 predicted 1329
5 SASI_Rn02_00272011 predicted 1984
6 SASI_Rn02_00272012 predicted 1325
7 SASI_Rn02_00272013 predicted 1681
8 SASI_Rn02_00272014 predicted 926
9 SASI_Rn02_00272015 predicted 1517
10 SASI_Rn02_00272016 predicted 1959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272249 predicted 1100
2 SASI_Rn02_00272250 predicted 1228
3 SASI_Rn02_00272251 predicted 1554
4 SASI_Rn02_00272252 predicted 754
5 SASI_Rn02_00272253 predicted 1989
6 SASI_Rn02_00272254 predicted 1333
7 SASI_Rn02_00272255 predicted 1688
8 SASI_Rn02_00272256 predicted 925
9 SASI_Rn02_00272257 predicted 1524
10 SASI_Rn02_00272258 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395291 predicted 1228
2 SASI_Rn02_00395292 predicted 1548
3 SASI_Rn02_00395293 predicted 753
4 SASI_Rn02_00395294 predicted 1328
5 SASI_Rn02_00395295 predicted 1982
6 SASI_Rn02_00395296 predicted 1331
7 SASI_Rn02_00395297 predicted 1689
8 SASI_Rn02_00395298 predicted 923
9 SASI_Rn02_00395299 predicted 1520
10 SASI_Rn02_00395300 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298221 predicted 1300
2 SASI_Mm02_00298222 predicted 1678
3 SASI_Mm02_00298223 predicted 1696
4 SASI_Mm02_00298224 predicted 1253
5 SASI_Mm02_00298225 predicted 1696
6 SASI_Mm02_00298226 predicted 1733
7 SASI_Mm02_00298227 predicted 1392
8 SASI_Mm02_00298228 predicted 1952
9 SASI_Mm02_00298229 predicted 1056
10 SASI_Mm02_00298230 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256956 predicted 1556
2 SASI_Mm01_00256957 predicted 1212
3 SASI_Mm01_00256958 predicted 1836
4 SASI_Mm01_00256959 predicted 1567
5 SASI_Mm01_00256960 predicted 1703
6 SASI_Mm01_00256961 predicted 1351
7 SASI_Mm01_00256962 predicted 1726
8 SASI_Mm01_00256963 predicted 1561
9 SASI_Mm01_00256964 predicted 1565
10 SASI_Mm01_00256965 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262745 predicted 1250
2 SASI_Mm01_00262746 predicted 906
3 SASI_Mm01_00262747 predicted 1530
4 SASI_Mm01_00262748 predicted 1258
5 SASI_Mm01_00262749 predicted 1405
6 SASI_Mm01_00262750 predicted 1041
7 SASI_Mm01_00262751 predicted 1415
8 SASI_Mm01_00262752 predicted 1253
9 SASI_Mm01_00262753 predicted 1264
10 SASI_Mm01_00262754 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_031104
GALNT16 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000034929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-237s1c1
Sequence:CCGGCCTGGGCACTTTCTACTACTTCTCGAGAAGTAGTAGAAAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1265s1c1
Sequence:CCGGCCCTCACCTACATCAGGAATACTCGAGTATTCCTGATGTAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1078s1c1
Sequence:CCGGGTGATCGACAAGTCCTGGTTTCTCGAGAAACCAGGACTTGTCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-639s1c1
Sequence:CCGGTGCCAACTTGATCCAGGAGATCTCGAGATCTCCTGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_031104
GALNT16 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000034929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-237s1c1
Sequence:CCGGCCTGGGCACTTTCTACTACTTCTCGAGAAGTAGTAGAAAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1265s1c1
Sequence:CCGGCCCTCACCTACATCAGGAATACTCGAGTATTCCTGATGTAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1078s1c1
Sequence:CCGGGTGATCGACAAGTCCTGGTTTCTCGAGAAACCAGGACTTGTCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-639s1c1
Sequence:CCGGTGCCAACTTGATCCAGGAGATCTCGAGATCTCCTGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_031104
GALNT16 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000034929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-237s1c1
Sequence:CCGGCCTGGGCACTTTCTACTACTTCTCGAGAAGTAGTAGAAAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1265s1c1
Sequence:CCGGCCCTCACCTACATCAGGAATACTCGAGTATTCCTGATGTAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-1078s1c1
Sequence:CCGGGTGATCGACAAGTCCTGGTTTCTCGAGAAACCAGGACTTGTCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031104.7-639s1c1
Sequence:CCGGTGCCAACTTGATCCAGGAGATCTCGAGATCTCCTGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081421
GALNT16 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081421.1-2656s21c1
Sequence:CCGGTACACCCTGAAATACCCTTATCTCGAGATAAGGGTATTTCAGGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1250s21c1
Sequence:CCGGGGGCAATGCCCTCACCTATATCTCGAGATATAGGTGAGGGCATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-232s21c1
Sequence:CCGGTGGGCACTTTCTACTACTTATCTCGAGATAAGTAGTAGAAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1304s21c1
Sequence:CCGGGGACGAGTACAAACAGTATTACTCGAGTAATACTGTTTGTACTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1584s21c1
Sequence:CCGGCCAGCCCAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081421
GALNT16 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081421.1-2656s21c1
Sequence:CCGGTACACCCTGAAATACCCTTATCTCGAGATAAGGGTATTTCAGGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1250s21c1
Sequence:CCGGGGGCAATGCCCTCACCTATATCTCGAGATATAGGTGAGGGCATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-232s21c1
Sequence:CCGGTGGGCACTTTCTACTACTTATCTCGAGATAAGTAGTAGAAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1304s21c1
Sequence:CCGGGGACGAGTACAAACAGTATTACTCGAGTAATACTGTTTGTACTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1584s21c1
Sequence:CCGGCCAGCCCAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081421
GALNT16 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081421.1-2656s21c1
Sequence:CCGGTACACCCTGAAATACCCTTATCTCGAGATAAGGGTATTTCAGGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1250s21c1
Sequence:CCGGGGGCAATGCCCTCACCTATATCTCGAGATATAGGTGAGGGCATTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-232s21c1
Sequence:CCGGTGGGCACTTTCTACTACTTATCTCGAGATAAGTAGTAGAAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1304s21c1
Sequence:CCGGGGACGAGTACAAACAGTATTACTCGAGTAATACTGTTTGTACTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081421.1-1584s21c1
Sequence:CCGGCCAGCCCAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks