EMAIL THIS PAGE TO A FRIEND

GALNT18

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18

52 Gene Product Result for
Synonyms: GALNACT18 GALNT15 GALNTL4 GalNAc-T15 GalNAc-T18
UniProtKB ID: Q6P9A2, O95903, Q8NDY9
Gene ID:
Mouse(233733) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Rat(293181) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
domestic guinea pig(100734612) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
naked mole-rat(101710822) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198516 Rosetta Predictions human pricing
NM_001079884 Rosetta Predictions rat pricing
NM_173739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173126 predicted 2059
2 SASI_Hs01_00173127 predicted 1235
3 SASI_Hs01_00173128 predicted 1409
4 SASI_Hs01_00173129 predicted 1554
5 SASI_Hs01_00173130 predicted 1736
6 SASI_Hs01_00173131 predicted 1656
7 SASI_Hs01_00173132 predicted 1394
8 SASI_Hs01_00173133 predicted 1255
9 SASI_Hs01_00173134 predicted 1830
10 SASI_Hs02_00372096 predicted 1811
11 SASI_Hs01_00173135 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208149 predicted 1831
2 SASI_Rn02_00208150 predicted 2049
3 SASI_Rn02_00208151 predicted 1747
4 SASI_Rn02_00208152 predicted 1407
5 SASI_Rn02_00208153 predicted 1742
6 SASI_Rn02_00208154 predicted 2251
7 SASI_Rn02_00208155 predicted 1600
8 SASI_Rn02_00208156 predicted 1916
9 SASI_Rn02_00208157 predicted 2190
10 SASI_Rn02_00208158 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074219 predicted 1410
2 SASI_Mm01_00074220 predicted 2198
3 SASI_Mm01_00074221 predicted 2115
4 SASI_Mm02_00345383 predicted 2095
5 SASI_Mm01_00074222 predicted 973
6 SASI_Mm01_00074223 predicted 1980
7 SASI_Mm01_00074224 predicted 1427
8 SASI_Mm01_00074226 predicted 2322
9 SASI_Mm01_00074227 predicted 2345
10 SASI_Mm01_00074228 predicted 523
11 SASI_Mm01_00074225 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198516
VALIDATED
GALNT18 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2257s1c1
Sequence:CCGGCTGCCTCTTTGCTACTGTGTACTCGAGTACACAGTAGCAAAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-1244s1c1
Sequence:CCGGCCATCCTTTGATAACATCAAACTCGAGTTTGATGTTATCAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-751s1c1
Sequence:CCGGCCTGAAGCAATTCCAGTACTACTCGAGTAGTACTGGAATTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2098s1c1
Sequence:CCGGCATCCAGAACCGCAAGTCTAACTCGAGTTAGACTTGCGGTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198516
VALIDATED
GALNT18 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2257s1c1
Sequence:CCGGCTGCCTCTTTGCTACTGTGTACTCGAGTACACAGTAGCAAAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-1244s1c1
Sequence:CCGGCCATCCTTTGATAACATCAAACTCGAGTTTGATGTTATCAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-751s1c1
Sequence:CCGGCCTGAAGCAATTCCAGTACTACTCGAGTAGTACTGGAATTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2098s1c1
Sequence:CCGGCATCCAGAACCGCAAGTCTAACTCGAGTTAGACTTGCGGTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198516
VALIDATED
GALNT18 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2257s1c1
Sequence:CCGGCTGCCTCTTTGCTACTGTGTACTCGAGTACACAGTAGCAAAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-1244s1c1
Sequence:CCGGCCATCCTTTGATAACATCAAACTCGAGTTTGATGTTATCAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-751s1c1
Sequence:CCGGCCTGAAGCAATTCCAGTACTACTCGAGTAGTACTGGAATTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198516.1-2098s1c1
Sequence:CCGGCATCCAGAACCGCAAGTCTAACTCGAGTTAGACTTGCGGTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173739
GALNT18 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173739.3-2324s1c1
Sequence:CCGGCGCTTTGCTACTGTGTAGCATCTCGAGATGCTACACAGTAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1720s1c1
Sequence:CCGGTCATGTCTACATGGCATGGAACTCGAGTTCCATGCCATGTAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1042s1c1
Sequence:CCGGGCTGACTGAATATGTGGACAACTCGAGTTGTCCACATATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1415s1c1
Sequence:CCGGGCCCTCATTGGCTGTTTCATTCTCGAGAATGAAACAGCCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1957s1c1
Sequence:CCGGCGTGTACATATGCCATGGGATCTCGAGATCCCATGGCATATGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173739
GALNT18 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173739.3-2324s1c1
Sequence:CCGGCGCTTTGCTACTGTGTAGCATCTCGAGATGCTACACAGTAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1720s1c1
Sequence:CCGGTCATGTCTACATGGCATGGAACTCGAGTTCCATGCCATGTAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1042s1c1
Sequence:CCGGGCTGACTGAATATGTGGACAACTCGAGTTGTCCACATATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1415s1c1
Sequence:CCGGGCCCTCATTGGCTGTTTCATTCTCGAGAATGAAACAGCCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1957s1c1
Sequence:CCGGCGTGTACATATGCCATGGGATCTCGAGATCCCATGGCATATGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173739
GALNT18 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173739.3-2324s1c1
Sequence:CCGGCGCTTTGCTACTGTGTAGCATCTCGAGATGCTACACAGTAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1720s1c1
Sequence:CCGGTCATGTCTACATGGCATGGAACTCGAGTTCCATGCCATGTAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1042s1c1
Sequence:CCGGGCTGACTGAATATGTGGACAACTCGAGTTGTCCACATATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1415s1c1
Sequence:CCGGGCCCTCATTGGCTGTTTCATTCTCGAGAATGAAACAGCCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173739.3-1957s1c1
Sequence:CCGGCGTGTACATATGCCATGGGATCTCGAGATCCCATGGCATATGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks