EMAIL THIS PAGE TO A FRIEND

GALNT1

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)

203 Gene Product Result for
Synonyms: GALNAC-T1
UniProtKB ID: Q10472, Q86TJ7, Q9UM86
Gene ID:
Human(2589) Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
Mouse(14423) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1
Rat(79214) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
sheep(101109846) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
naked mole-rat(101709888) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
domestic guinea pig(100734456) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Zebrafish(559073) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1
cow(282241) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
domestic cat(101094456) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
chicken(420955) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
dog(480161) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020474 Rosetta Predictions human pricing
NM_024373 Rosetta Predictions rat pricing
NM_013814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164136 predicted 586
2 SASI_Hs01_00164137 predicted 1337
3 SASI_Hs01_00164138 predicted 799
4 SASI_Hs01_00164139 predicted 290
5 SASI_Hs01_00164140 predicted 946
6 SASI_Hs01_00164141 predicted 623
7 SASI_Hs01_00164142 predicted 581
8 SASI_Hs01_00164144 predicted 468
9 SASI_Hs01_00164145 predicted 1189
10 SASI_Hs02_00353556 predicted 223
11 SASI_Hs01_00164143 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031243 predicted 760
2 SASI_Rn01_00031244 predicted 662
3 SASI_Rn02_00263962 predicted 1406
4 SASI_Rn01_00031245 predicted 1611
5 SASI_Rn01_00031246 predicted 1021
6 SASI_Rn01_00031247 predicted 796
7 SASI_Rn01_00031248 predicted 884
8 SASI_Rn01_00031249 predicted 1405
9 SASI_Rn01_00031250 predicted 872
10 SASI_Rn01_00031252 predicted 1261
11 SASI_Rn01_00031251 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120230 predicted 535
2 SASI_Mm01_00120231 predicted 575
3 SASI_Mm01_00120232 predicted 1452
4 SASI_Mm01_00120233 predicted 1242
5 SASI_Mm01_00120234 predicted 969
6 SASI_Mm02_00322774 predicted 1807
7 SASI_Mm01_00120235 predicted 513
8 SASI_Mm01_00120236 predicted 1559
9 SASI_Mm01_00120237 predicted 954
10 SASI_Mm01_00120238 predicted 1170
11 SASI_Mm01_00120239 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013814
VALIDATED
GALNT1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1537s21c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1491s21c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013814.3-2079s21c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1862s21c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1996s1c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1454s1c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013814.2-1779s1c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1408s1c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013814
VALIDATED
GALNT1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1537s21c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1491s21c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013814.3-2079s21c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1862s21c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1996s1c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1454s1c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013814.2-1779s1c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1408s1c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013814
VALIDATED
GALNT1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1537s21c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1491s21c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013814.3-2079s21c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013814.3-1862s21c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1996s1c1
Sequence:CCGGGCCACATTCTTCAGTAGCAAACTCGAGTTTGCTACTGAAGAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1454s1c1
Sequence:CCGGGCCTAAGACGTAAACTACAATCTCGAGATTGTAGTTTACGTCTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013814.2-1779s1c1
Sequence:CCGGCCCAGTGAAATTAACCCTGCACTCGAGTGCAGGGTTAATTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013814.2-1408s1c1
Sequence:CCGGCCAGGTGTTACAAAGGTAGATCTCGAGATCTACCTTTGTAACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020474
VALIDATED
GALNT1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1964s21c1
Sequence:CCGGGACGTGAAACTGCATAGTAATCTCGAGATTACTATGCAGTTTCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1697s21c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-395s21c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1539s21c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-658s21c1
Sequence:CCGGATTGATCAGAGCTAGATTAAACTCGAGTTTAATCTAGCTCTGATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020474.2-1488s1c1
Sequence:CCGGCCAAACTTAATGGCCCAGTTACTCGAGTAACTGGGCCATTAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1634s1c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-332s1c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1476s1c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-461s1c1
Sequence:CCGGCCAAGACACATGATAGAAGAACTCGAGTTCTTCTATCATGTGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020474
VALIDATED
GALNT1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1964s21c1
Sequence:CCGGGACGTGAAACTGCATAGTAATCTCGAGATTACTATGCAGTTTCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1697s21c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-395s21c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1539s21c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-658s21c1
Sequence:CCGGATTGATCAGAGCTAGATTAAACTCGAGTTTAATCTAGCTCTGATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020474.2-1488s1c1
Sequence:CCGGCCAAACTTAATGGCCCAGTTACTCGAGTAACTGGGCCATTAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1634s1c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-332s1c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1476s1c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-461s1c1
Sequence:CCGGCCAAGACACATGATAGAAGAACTCGAGTTCTTCTATCATGTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020474
VALIDATED
GALNT1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1964s21c1
Sequence:CCGGGACGTGAAACTGCATAGTAATCTCGAGATTACTATGCAGTTTCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1697s21c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-395s21c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-1539s21c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020474.3-658s21c1
Sequence:CCGGATTGATCAGAGCTAGATTAAACTCGAGTTTAATCTAGCTCTGATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020474.2-1488s1c1
Sequence:CCGGCCAAACTTAATGGCCCAGTTACTCGAGTAACTGGGCCATTAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1634s1c1
Sequence:CCGGCCCAGCATTAGAGACTGCAATCTCGAGATTGCAGTCTCTAATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-332s1c1
Sequence:CCGGGTTAGGTTAGAAGGGTGTAAACTCGAGTTTACACCCTTCTAACCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-1476s1c1
Sequence:CCGGGCTTGGATGTTTCCAAACTTACTCGAGTAAGTTTGGAAACATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020474.2-461s1c1
Sequence:CCGGCCAAGACACATGATAGAAGAACTCGAGTTCTTCTATCATGTGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)