EMAIL THIS PAGE TO A FRIEND

GALNT2

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)

89 Gene Product Result for
Synonyms: GalNAc-T2
UniProtKB ID: Q10471, A8K1Y3, C5HU00, Q9NPY4
Gene ID:
Human(2590) Summary: This gene encodes polypeptide N-acetylgalactosaminyltransferase 2, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation in a cell is regulated by a repertoire of GalNAc-transferases. [provided by RefSeq, Jul 2008]
Mouse(108148) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2
Rat(292090) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Zebrafish(570248) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2
domestic cat(101094703) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
cow(616218) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Horse(100065695) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
dog(100682763) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
chicken(421540) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
sheep(101102616) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Domestic Rabbit(100338673) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
naked mole-rat(101718473) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
domestic guinea pig(100724116) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004481 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004481 Rosetta Predictions human pricing
NM_001106196 Rosetta Predictions rat pricing
NM_139272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220036 predicted 563
2 SASI_Hs01_00220037 predicted 1355
3 SASI_Hs01_00220038 predicted 317
4 SASI_Hs02_00337701 predicted 1774
5 SASI_Hs02_00337702 predicted 570
6 SASI_Hs01_00220042 predicted 1360
7 SASI_Hs01_00220043 predicted 825
8 SASI_Hs01_00220044 predicted 914
9 SASI_Hs02_00337703 predicted 758
10 SASI_Hs01_00220045 predicted 1402
11 SASI_Hs01_00220039 predicted 1788
12 SASI_Hs01_00220040 predicted 847
13 SASI_Hs01_00220041 predicted 1781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216578 predicted 1543
2 SASI_Rn02_00216579 predicted 1171
3 SASI_Rn02_00216580 predicted 1550
4 SASI_Rn02_00216581 predicted 1604
5 SASI_Rn02_00216582 predicted 704
6 SASI_Rn02_00216583 predicted 716
7 SASI_Rn02_00216584 predicted 1267
8 SASI_Rn02_00216585 predicted 1219
9 SASI_Rn02_00216586 predicted 659
10 SASI_Rn02_00216587 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132143 predicted 964
2 SASI_Mm01_00132144 predicted 1518
3 SASI_Mm01_00132145 predicted 1943
4 SASI_Mm01_00132146 predicted 966
5 SASI_Mm01_00132147 predicted 1738
6 SASI_Mm01_00132148 predicted 1335
7 SASI_Mm01_00132149 predicted 1507
8 SASI_Mm01_00132150 predicted 887
9 SASI_Mm01_00132151 predicted 1538
10 SASI_Mm02_00339968 predicted 1561
11 SASI_Mm01_00132142 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139272
VALIDATED
GALNT2 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-3025s1c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-547s1c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1063s1c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1521s1c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139272.2-1060s1c1
Sequence:CCGGCTTCGTGATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1063s21c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-547s21c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1521s21c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139272.2-3025s21c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139272
VALIDATED
GALNT2 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-3025s1c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-547s1c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1063s1c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1521s1c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139272.2-1060s1c1
Sequence:CCGGCTTCGTGATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1063s21c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-547s21c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1521s21c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139272.2-3025s21c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139272
VALIDATED
GALNT2 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-3025s1c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-547s1c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1063s1c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_139272.2-1521s1c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139272.2-1060s1c1
Sequence:CCGGCTTCGTGATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1063s21c1
Sequence:CCGGCGTGATGGACAAGCTCTATTTCTCGAGAAATAGAGCTTGTCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-547s21c1
Sequence:CCGGCGTGGTGATCACATTCCACAACTCGAGTTGTGGAATGTGATCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139272.2-1521s21c1
Sequence:CCGGCGGATGGAGTTGTTGGAATTTCTCGAGAAATTCCAACAACTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139272.2-3025s21c1
Sequence:CCGGGCAGGAATTATGGGTAGAGTTCTCGAGAACTCTACCCATAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004481
VALIDATED
GALNT2 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1807s1c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1273s1c1
Sequence:CCGGCCTTTCAAATGGTACCTTGAACTCGAGTTCAAGGTACCATTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-586s1c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1369s1c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-927s1c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-658s21c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-999s21c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004481.3-1879s21c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-1441s21c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004481
VALIDATED
GALNT2 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1807s1c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1273s1c1
Sequence:CCGGCCTTTCAAATGGTACCTTGAACTCGAGTTCAAGGTACCATTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-586s1c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1369s1c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-927s1c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-658s21c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-999s21c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004481.3-1879s21c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-1441s21c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004481
VALIDATED
GALNT2 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1807s1c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1273s1c1
Sequence:CCGGCCTTTCAAATGGTACCTTGAACTCGAGTTCAAGGTACCATTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-586s1c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004481.2-1369s1c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004481.2-927s1c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-658s21c1
Sequence:CCGGCTTAGAAATGATCGACGAGAACTCGAGTTCTCGTCGATCATTTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-999s21c1
Sequence:CCGGGCTGTTTGTGATGGATAAGTTCTCGAGAACTTATCCATCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004481.3-1879s21c1
Sequence:CCGGCGAAACTAATATACCTCAGTACTCGAGTACTGAGGTATATTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004481.3-1441s21c1
Sequence:CCGGCTCGACACTTTGGGACACTTTCTCGAGAAAGTGTCCCAAAGTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks