EMAIL THIS PAGE TO A FRIEND

GALNT3

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)

106 Gene Product Result for
Synonyms: GalNAc-T3 HFTC HHS
UniProtKB ID: Q14435, Q53TG9, Q7Z476
Gene ID:
Human(2591) Summary: This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
Mouse(14425) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3
Rat(366061) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
domestic guinea pig(100715369) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
naked mole-rat(101710129) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
sheep(101102875) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Domestic Rabbit(100353918) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Zebrafish(100331984) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
dog(478774) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
cow(535458) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Horse(100051940) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
domestic cat(101081320) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
chicken(424177) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004482 Rosetta Predictions human pricing
NM_001015032 Rosetta Predictions rat pricing
NM_015736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175326 predicted 644
2 SASI_Hs02_00337704 predicted 2105
3 SASI_Hs01_00175327 predicted 2390
4 SASI_Hs02_00337705 predicted 446
5 SASI_Hs02_00337706 predicted 2161
6 SASI_Hs01_00175328 predicted 1951
7 SASI_Hs01_00175329 predicted 830
8 SASI_Hs01_00175330 predicted 1433
9 SASI_Hs01_00175331 predicted 766
10 SASI_Hs01_00175332 predicted 2374
11 SASI_Hs01_00175333 predicted 1720
12 SASI_Hs01_00175334 predicted 891
13 SASI_Hs01_00175335 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120276 predicted 1618
2 SASI_Rn01_00120277 predicted 1025
3 SASI_Rn02_00202157 predicted 1916
4 SASI_Rn01_00120279 predicted 1741
5 SASI_Rn01_00120280 predicted 1690
6 SASI_Rn01_00120281 predicted 1610
7 SASI_Rn02_00202158 predicted 239
8 SASI_Rn01_00120283 predicted 1413
9 SASI_Rn01_00120284 predicted 305
10 SASI_Rn02_00202159 predicted 1579
11 SASI_Rn01_00120275 predicted 2114
12 SASI_Rn01_00120278 predicted 1784
13 SASI_Rn01_00120282 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089276 predicted 2368
2 SASI_Mm01_00089277 predicted 1848
3 SASI_Mm01_00089278 predicted 630
4 SASI_Mm01_00089279 predicted 1303
5 SASI_Mm01_00089280 predicted 415
6 SASI_Mm01_00089281 predicted 2011
7 SASI_Mm01_00089282 predicted 2156
8 SASI_Mm01_00089283 predicted 1995
9 SASI_Mm01_00089284 predicted 2206
10 SASI_Mm01_00089285 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015736
GALNT3 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1293s21c1
Sequence:CCGGCATCGCATCCATAGATCTAAACTCGAGTTTAGATCTATGGATGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1339s21c1
Sequence:CCGGCCGTACGGAAGCAACCATAACCTCGAGGTTATGGTTGCTTCCGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-618s21c1
Sequence:CCGGGCAAATAGGAGCGCCCATTAACTCGAGTTAATGGGCGCTCCTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1193s1c1
Sequence:CCGGGCAACCATAACCGTGGAAATTCTCGAGAATTTCCACGGTTATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-730s1c1
Sequence:CCGGCCACCTGAATGTATTGAACAACTCGAGTTGTTCAATACATTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-448s1c1
Sequence:CCGGGCAATGCCAAAGATGCAAATACTCGAGTATTTGCATCTTTGGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1772s1c1
Sequence:CCGGGTCTGGATGTTGGTGAGAATACTCGAGTATTCTCACCAACATCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1996s1c1
Sequence:CCGGCGGAAGGACCAACTTCTATATCTCGAGATATAGAAGTTGGTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015736
GALNT3 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1293s21c1
Sequence:CCGGCATCGCATCCATAGATCTAAACTCGAGTTTAGATCTATGGATGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1339s21c1
Sequence:CCGGCCGTACGGAAGCAACCATAACCTCGAGGTTATGGTTGCTTCCGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-618s21c1
Sequence:CCGGGCAAATAGGAGCGCCCATTAACTCGAGTTAATGGGCGCTCCTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1193s1c1
Sequence:CCGGGCAACCATAACCGTGGAAATTCTCGAGAATTTCCACGGTTATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-730s1c1
Sequence:CCGGCCACCTGAATGTATTGAACAACTCGAGTTGTTCAATACATTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-448s1c1
Sequence:CCGGGCAATGCCAAAGATGCAAATACTCGAGTATTTGCATCTTTGGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1772s1c1
Sequence:CCGGGTCTGGATGTTGGTGAGAATACTCGAGTATTCTCACCAACATCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1996s1c1
Sequence:CCGGCGGAAGGACCAACTTCTATATCTCGAGATATAGAAGTTGGTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015736
GALNT3 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1293s21c1
Sequence:CCGGCATCGCATCCATAGATCTAAACTCGAGTTTAGATCTATGGATGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-1339s21c1
Sequence:CCGGCCGTACGGAAGCAACCATAACCTCGAGGTTATGGTTGCTTCCGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015736.2-618s21c1
Sequence:CCGGGCAAATAGGAGCGCCCATTAACTCGAGTTAATGGGCGCTCCTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1193s1c1
Sequence:CCGGGCAACCATAACCGTGGAAATTCTCGAGAATTTCCACGGTTATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-730s1c1
Sequence:CCGGCCACCTGAATGTATTGAACAACTCGAGTTGTTCAATACATTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-448s1c1
Sequence:CCGGGCAATGCCAAAGATGCAAATACTCGAGTATTTGCATCTTTGGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1772s1c1
Sequence:CCGGGTCTGGATGTTGGTGAGAATACTCGAGTATTCTCACCAACATCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015736.1-1996s1c1
Sequence:CCGGCGGAAGGACCAACTTCTATATCTCGAGATATAGAAGTTGGTCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004482
VALIDATED
GALNT3 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1219s21c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-700s21c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1011s21c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1285s21c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-624s1c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-832s1c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-313s1c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-898s1c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-1495s1c1
Sequence:CCGGCCAGACCTTAATCCTGTTATACTCGAGTATAACAGGATTAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004482
VALIDATED
GALNT3 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1219s21c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-700s21c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1011s21c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1285s21c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-624s1c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-832s1c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-313s1c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-898s1c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-1495s1c1
Sequence:CCGGCCAGACCTTAATCCTGTTATACTCGAGTATAACAGGATTAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004482
VALIDATED
GALNT3 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1219s21c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-700s21c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1011s21c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004482.3-1285s21c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-624s1c1
Sequence:CCGGGCTCTATTCTTCACCTGCAATCTCGAGATTGCAGGTGAAGAATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-832s1c1
Sequence:CCGGGCTCACTGTGAGTGTTTCTATCTCGAGATAGAAACACTCACAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-313s1c1
Sequence:CCGGGCAGAATTGAAGCCTGTCCTTCTCGAGAAGGACAGGCTTCAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-898s1c1
Sequence:CCGGGCTGTCGTAAGTCCAGATATTCTCGAGAATATCTGGACTTACGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004482.2-1495s1c1
Sequence:CCGGCCAGACCTTAATCCTGTTATACTCGAGTATAACAGGATTAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)