EMAIL THIS PAGE TO A FRIEND

GALNT4

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)

155 Gene Product Result for
Synonyms: GALNAC-T4 GALNACT4
UniProtKB ID: Q8N4A0, B2R775, B4DMX6, O00208
Gene ID:
Human(8693) Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
Mouse(14426) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4
Rat(500826) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
chicken(101666408) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
domestic cat(101097905) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
cow(100125265) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Horse(100063207) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
sheep(101111006) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
naked mole-rat(101726734) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
domestic guinea pig(100729195) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003774 Rosetta Predictions human pricing
NM_001025053 Rosetta Predictions rat pricing
NM_015737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229579 predicted 623
2 SASI_Hs01_00229580 predicted 501
3 SASI_Hs01_00229581 predicted 649
4 SASI_Hs01_00229582 predicted 883
5 SASI_Hs01_00229583 predicted 818
6 SASI_Hs01_00229585 predicted 797
7 SASI_Hs01_00229586 predicted 1622
8 SASI_Hs01_00229587 predicted 956
9 SASI_Hs01_00229588 predicted 1756
10 SASI_Hs02_00336270 predicted 493
11 SASI_Hs01_00229584 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058188 predicted 1688
2 SASI_Rn02_00202985 predicted 986
3 SASI_Rn01_00058190 predicted 799
4 SASI_Rn01_00058191 predicted 1218
5 SASI_Rn01_00058192 predicted 1613
6 SASI_Rn01_00058193 predicted 1081
7 SASI_Rn02_00202986 predicted 1768
8 SASI_Rn01_00058195 predicted 1418
9 SASI_Rn01_00058196 predicted 975
10 SASI_Rn01_00058197 predicted 916
11 SASI_Rn01_00058189 predicted 541
12 SASI_Rn01_00058194 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141304 predicted 797
2 SASI_Mm02_00323062 predicted 688
3 SASI_Mm01_00141305 predicted 1007
4 SASI_Mm01_00141306 predicted 802
5 SASI_Mm02_00323063 predicted 1036
6 SASI_Mm01_00141307 predicted 1109
7 SASI_Mm01_00141308 predicted 854
8 SASI_Mm01_00141309 predicted 1802
9 SASI_Mm01_00141310 predicted 1753
10 SASI_Mm01_00141311 predicted 1533
11 SASI_Mm01_00141312 predicted 448
12 SASI_Mm01_00141313 predicted 1808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003774
VALIDATED
GALNT4 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-546s1c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1651s1c1
Sequence:CCGGGAGGCAATCAATTCTTTGAATCTCGAGATTCAAAGAATTGATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-969s1c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1471s1c1
Sequence:CCGGGCAAGAGCTTTGACTGGTATTCTCGAGAATACCAGTCAAAGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1050s1c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003774.3-2136s21c1
Sequence:CCGGATTTCACAATGCCTTACTTATCTCGAGATAAGTAAGGCATTGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-546s21c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003774.3-787s21c1
Sequence:CCGGTTGATAGAGTACGCTTGATTACTCGAGTAATCAAGCGTACTCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-969s21c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-1050s21c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003774
VALIDATED
GALNT4 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-546s1c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1651s1c1
Sequence:CCGGGAGGCAATCAATTCTTTGAATCTCGAGATTCAAAGAATTGATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-969s1c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1471s1c1
Sequence:CCGGGCAAGAGCTTTGACTGGTATTCTCGAGAATACCAGTCAAAGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1050s1c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003774.3-2136s21c1
Sequence:CCGGATTTCACAATGCCTTACTTATCTCGAGATAAGTAAGGCATTGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-546s21c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003774.3-787s21c1
Sequence:CCGGTTGATAGAGTACGCTTGATTACTCGAGTAATCAAGCGTACTCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-969s21c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-1050s21c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003774
VALIDATED
GALNT4 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-546s1c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1651s1c1
Sequence:CCGGGAGGCAATCAATTCTTTGAATCTCGAGATTCAAAGAATTGATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-969s1c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1471s1c1
Sequence:CCGGGCAAGAGCTTTGACTGGTATTCTCGAGAATACCAGTCAAAGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003774.3-1050s1c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003774.3-2136s21c1
Sequence:CCGGATTTCACAATGCCTTACTTATCTCGAGATAAGTAAGGCATTGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-546s21c1
Sequence:CCGGCATCGACACATAGAGGATAAACTCGAGTTTATCCTCTATGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003774.3-787s21c1
Sequence:CCGGTTGATAGAGTACGCTTGATTACTCGAGTAATCAAGCGTACTCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-969s21c1
Sequence:CCGGCCTGTTATAGACACAATTGATCTCGAGATCAATTGTGTCTATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003774.3-1050s21c1
Sequence:CCGGCGTTTAACATTTCAGTGGCATCTCGAGATGCCACTGAAATGTTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015737
VALIDATED
GALNT4 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-658s1c1
Sequence:CCGGCCGTTATCATCGCCTTCTATACTCGAGTATAGAAGGCGATGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-1815s1c1
Sequence:CCGGCCAGTTCCAGTGAACATCATTCTCGAGAATGATGTTCACTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-992s1c1
Sequence:CCGGCGCAATCGTATGTCCTGTCATCTCGAGATGACAGGACATACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-2337s1c1
Sequence:CCGGCCACAGCACCACAAACTACATCTCGAGATGTAGTTTGTGGTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-935s1c1
Sequence:CCGGTGAGTGTAACACTGGTTGGTTCTCGAGAACCAACCAGTGTTACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015737
VALIDATED
GALNT4 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-658s1c1
Sequence:CCGGCCGTTATCATCGCCTTCTATACTCGAGTATAGAAGGCGATGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-1815s1c1
Sequence:CCGGCCAGTTCCAGTGAACATCATTCTCGAGAATGATGTTCACTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-992s1c1
Sequence:CCGGCGCAATCGTATGTCCTGTCATCTCGAGATGACAGGACATACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-2337s1c1
Sequence:CCGGCCACAGCACCACAAACTACATCTCGAGATGTAGTTTGTGGTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-935s1c1
Sequence:CCGGTGAGTGTAACACTGGTTGGTTCTCGAGAACCAACCAGTGTTACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015737
VALIDATED
GALNT4 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-658s1c1
Sequence:CCGGCCGTTATCATCGCCTTCTATACTCGAGTATAGAAGGCGATGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-1815s1c1
Sequence:CCGGCCAGTTCCAGTGAACATCATTCTCGAGAATGATGTTCACTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015737.2-992s1c1
Sequence:CCGGCGCAATCGTATGTCCTGTCATCTCGAGATGACAGGACATACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-2337s1c1
Sequence:CCGGCCACAGCACCACAAACTACATCTCGAGATGTAGTTTGTGGTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015737.2-935s1c1
Sequence:CCGGTGAGTGTAACACTGGTTGGTTCTCGAGAACCAACCAGTGTTACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks