EMAIL THIS PAGE TO A FRIEND

GALNT5

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)

58 Gene Product Result for
Synonyms: GALNAC-T5 GALNACT5
UniProtKB ID: Q7Z7M9, A5PKZ1, Q9UGK7, Q9UHL6
Gene ID:
Mouse(241391) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5
Rat(83627) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
domestic guinea pig(100725254) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
naked mole-rat(101714551) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
sheep(101113990) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Domestic Rabbit(100356802) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
chicken(424324) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
cow(504711) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Horse(100050823) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
domestic cat(101090539) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
dog(488359) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014568 Rosetta Predictions human pricing
NM_031796 Rosetta Predictions rat pricing
NM_172855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345832 predicted 886
2 SASI_Hs02_00345833 predicted 1747
3 SASI_Hs01_00234548 predicted 850
4 SASI_Hs01_00234549 predicted 1067
5 SASI_Hs01_00234550 predicted 1114
6 SASI_Hs01_00234552 predicted 1653
7 SASI_Hs01_00234554 predicted 1462
8 SASI_Hs01_00234555 predicted 906
9 SASI_Hs01_00234556 predicted 1032
10 SASI_Hs01_00234557 predicted 2132
11 SASI_Hs01_00234551 predicted 1396
12 SASI_Hs01_00234553 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059966 predicted 2907
2 SASI_Rn01_00059967 predicted 1714
3 SASI_Rn02_00265235 predicted 1089
4 SASI_Rn01_00059969 predicted 2917
5 SASI_Rn01_00059970 predicted 2787
6 SASI_Rn01_00059971 predicted 2711
7 SASI_Rn02_00265236 predicted 2831
8 SASI_Rn01_00059972 predicted 2959
9 SASI_Rn01_00059973 predicted 2180
10 SASI_Rn02_00265237 predicted 1816
11 SASI_Rn01_00059965 predicted 2833
12 SASI_Rn01_00059968 predicted 953
13 SASI_Rn01_00059974 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344803 predicted 508
2 SASI_Mm02_00344804 predicted 1167
3 SASI_Mm01_00030253 predicted 2907
4 SASI_Mm01_00030254 predicted 1967
5 SASI_Mm01_00030255 predicted 1383
6 SASI_Mm01_00030256 predicted 1836
7 SASI_Mm01_00030257 predicted 1942
8 SASI_Mm01_00030258 predicted 1068
9 SASI_Mm01_00030259 predicted 2045
10 SASI_Mm02_00344805 predicted 1214
11 SASI_Mm01_00030251 predicted 3354
12 SASI_Mm01_00030252 predicted 3312
13 SASI_Mm01_00030260 predicted 2582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014568
VALIDATED
GALNT5 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-2794s21c1
Sequence:CCGGACCTGGTTAAGACTTATTAAACTCGAGTTTAATAAGTCTTAACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1467s21c1
Sequence:CCGGATACAACCAGAGTCATATAAACTCGAGTTTATATGACTCTGGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1647s21c1
Sequence:CCGGCAATGTCTACCTTAGCGATTTCTCGAGAAATCGCTAAGGTAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-1714s1c1
Sequence:CCGGGCAGAGCAGCTAGTTCACAATCTCGAGATTGTGAACTAGCTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-357s1c1
Sequence:CCGGCCTCTCATTCAGTGAGATCAACTCGAGTTGATCTCACTGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014568.1-2904s1c1
Sequence:CCGGGCATAAATCAACATCAGTCTTCTCGAGAAGACTGATGTTGATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-2098s1c1
Sequence:CCGGCCAGTAATCGAAGTCATCAATCTCGAGATTGATGACTTCGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014568
VALIDATED
GALNT5 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-2794s21c1
Sequence:CCGGACCTGGTTAAGACTTATTAAACTCGAGTTTAATAAGTCTTAACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1467s21c1
Sequence:CCGGATACAACCAGAGTCATATAAACTCGAGTTTATATGACTCTGGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1647s21c1
Sequence:CCGGCAATGTCTACCTTAGCGATTTCTCGAGAAATCGCTAAGGTAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-1714s1c1
Sequence:CCGGGCAGAGCAGCTAGTTCACAATCTCGAGATTGTGAACTAGCTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-357s1c1
Sequence:CCGGCCTCTCATTCAGTGAGATCAACTCGAGTTGATCTCACTGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014568.1-2904s1c1
Sequence:CCGGGCATAAATCAACATCAGTCTTCTCGAGAAGACTGATGTTGATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-2098s1c1
Sequence:CCGGCCAGTAATCGAAGTCATCAATCTCGAGATTGATGACTTCGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014568
VALIDATED
GALNT5 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-2794s21c1
Sequence:CCGGACCTGGTTAAGACTTATTAAACTCGAGTTTAATAAGTCTTAACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1467s21c1
Sequence:CCGGATACAACCAGAGTCATATAAACTCGAGTTTATATGACTCTGGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014568.1-1647s21c1
Sequence:CCGGCAATGTCTACCTTAGCGATTTCTCGAGAAATCGCTAAGGTAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-1714s1c1
Sequence:CCGGGCAGAGCAGCTAGTTCACAATCTCGAGATTGTGAACTAGCTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-357s1c1
Sequence:CCGGCCTCTCATTCAGTGAGATCAACTCGAGTTGATCTCACTGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014568.1-2904s1c1
Sequence:CCGGGCATAAATCAACATCAGTCTTCTCGAGAAGACTGATGTTGATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014568.1-2098s1c1
Sequence:CCGGCCAGTAATCGAAGTCATCAATCTCGAGATTGATGACTTCGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172855
GALNT5 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-354s21c1
Sequence:CCGGTCAACGCAGGGCTACTCAAAGCTCGAGCTTTGAGTAGCCCTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-1057s21c1
Sequence:CCGGCATTGCAGATATGGGTCATTTCTCGAGAAATGACCCATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-781s21c1
Sequence:CCGGACGTACAGAAACCTTCGATAACTCGAGTTATCGAAGGTTTCTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-2742s21c1
Sequence:CCGGATACCTGGGTAAGACTTATTACTCGAGTAATAAGTCTTACCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172855.1-3357s1c1
Sequence:CCGGGCTGACTGAATTTCTCTCCATCTCGAGATGGAGAGAAATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1109s1c1
Sequence:CCGGGCGATACATCAAAGCAAGCATCTCGAGATGCTTGCTTTGATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1706s1c1
Sequence:CCGGGCCATGCAAATATCCCTGAAACTCGAGTTTCAGGGATATTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-2580s1c1
Sequence:CCGGGCTATCATTCAAGGTCTGGATCTCGAGATCCAGACCTTGAATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-3090s1c1
Sequence:CCGGCCATTGTGACAACAGAAACAACTCGAGTTGTTTCTGTTGTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172855
GALNT5 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-354s21c1
Sequence:CCGGTCAACGCAGGGCTACTCAAAGCTCGAGCTTTGAGTAGCCCTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-1057s21c1
Sequence:CCGGCATTGCAGATATGGGTCATTTCTCGAGAAATGACCCATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-781s21c1
Sequence:CCGGACGTACAGAAACCTTCGATAACTCGAGTTATCGAAGGTTTCTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-2742s21c1
Sequence:CCGGATACCTGGGTAAGACTTATTACTCGAGTAATAAGTCTTACCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172855.1-3357s1c1
Sequence:CCGGGCTGACTGAATTTCTCTCCATCTCGAGATGGAGAGAAATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1109s1c1
Sequence:CCGGGCGATACATCAAAGCAAGCATCTCGAGATGCTTGCTTTGATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1706s1c1
Sequence:CCGGGCCATGCAAATATCCCTGAAACTCGAGTTTCAGGGATATTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-2580s1c1
Sequence:CCGGGCTATCATTCAAGGTCTGGATCTCGAGATCCAGACCTTGAATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-3090s1c1
Sequence:CCGGCCATTGTGACAACAGAAACAACTCGAGTTGTTTCTGTTGTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172855
GALNT5 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-354s21c1
Sequence:CCGGTCAACGCAGGGCTACTCAAAGCTCGAGCTTTGAGTAGCCCTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-1057s21c1
Sequence:CCGGCATTGCAGATATGGGTCATTTCTCGAGAAATGACCCATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-781s21c1
Sequence:CCGGACGTACAGAAACCTTCGATAACTCGAGTTATCGAAGGTTTCTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172855.3-2742s21c1
Sequence:CCGGATACCTGGGTAAGACTTATTACTCGAGTAATAAGTCTTACCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172855.1-3357s1c1
Sequence:CCGGGCTGACTGAATTTCTCTCCATCTCGAGATGGAGAGAAATTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1109s1c1
Sequence:CCGGGCGATACATCAAAGCAAGCATCTCGAGATGCTTGCTTTGATGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-1706s1c1
Sequence:CCGGGCCATGCAAATATCCCTGAAACTCGAGTTTCAGGGATATTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-2580s1c1
Sequence:CCGGGCTATCATTCAAGGTCTGGATCTCGAGATCCAGACCTTGAATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172855.1-3090s1c1
Sequence:CCGGCCATTGTGACAACAGAAACAACTCGAGTTGTTTCTGTTGTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks