EMAIL THIS PAGE TO A FRIEND

GALNT6

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)

Synonyms: GALNAC-T6 GalNAcT6
UniProtKB ID: Q8NCL4, Q8IYH4, Q9H6G2, Q9UIV5
Gene ID:
Human(11226) Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Mouse(207839) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6
Rat(100361647) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Zebrafish(406477) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
cow(506903) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Horse(100060897) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
domestic cat(101096076) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
dog(607787) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
chicken(429501) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
sheep(101114859) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Domestic Rabbit(100348815) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
naked mole-rat(101714462) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
domestic guinea pig(100716943) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029771 MISSION® esiRNA esiRNA targeting mouse Galnt6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007210 Rosetta Predictions human pricing
NM_172451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066988 predicted 720
2 SASI_Hs01_00066989 predicted 903
3 SASI_Hs02_00343196 predicted 495
4 SASI_Hs01_00066990 predicted 2281
5 SASI_Hs02_00343197 predicted 510
6 SASI_Hs01_00066992 predicted 2078
7 SASI_Hs01_00066993 predicted 856
8 SASI_Hs01_00066994 predicted 1682
9 SASI_Hs02_00343198 predicted 2262
10 SASI_Hs01_00066996 predicted 1963
11 SASI_Hs01_00066991 predicted 1491
12 SASI_Hs01_00066995 predicted 1460
13 SASI_Hs01_00066997 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343969 predicted 755
2 SASI_Mm01_00027157 predicted 1979
3 SASI_Mm01_00027158 predicted 793
4 SASI_Mm02_00343970 predicted 2141
5 SASI_Mm01_00027160 predicted 563
6 SASI_Mm01_00027162 predicted 2123
7 SASI_Mm01_00027163 predicted 744
8 SASI_Mm01_00027164 predicted 1717
9 SASI_Mm01_00027165 predicted 1749
10 SASI_Mm01_00027166 predicted 790
11 SASI_Mm01_00027159 predicted 1936
12 SASI_Mm01_00027161 predicted 1914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007210
GALNT6 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-178s1c1
Sequence:CCGGGCCATGAACAACCTTAGAGATCTCGAGATCTCTAAGGTTGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1443s1c1
Sequence:CCGGGCACAATGTCTACCCAGAGATCTCGAGATCTCTGGGTAGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-237s1c1
Sequence:CCGGGCAGACTCTGTTCTCCATAAACTCGAGTTTATGGAGAACAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1593s1c1
Sequence:CCGGCGGCAACCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1107s1c1
Sequence:CCGGCGGTACCTATGATAATCAGATCTCGAGATCTGATTATCATAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007210.3-2269s21c1
Sequence:CCGGAGCTTCTCTGGAGGCCGTAAACTCGAGTTTACGGCCTCCAGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007210.3-976s21c1
Sequence:CCGGAGCACAGAGGAGCACCTAAAGCTCGAGCTTTAGGTGCTCCTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007210
GALNT6 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-178s1c1
Sequence:CCGGGCCATGAACAACCTTAGAGATCTCGAGATCTCTAAGGTTGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1443s1c1
Sequence:CCGGGCACAATGTCTACCCAGAGATCTCGAGATCTCTGGGTAGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-237s1c1
Sequence:CCGGGCAGACTCTGTTCTCCATAAACTCGAGTTTATGGAGAACAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1593s1c1
Sequence:CCGGCGGCAACCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1107s1c1
Sequence:CCGGCGGTACCTATGATAATCAGATCTCGAGATCTGATTATCATAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007210.3-2269s21c1
Sequence:CCGGAGCTTCTCTGGAGGCCGTAAACTCGAGTTTACGGCCTCCAGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007210.3-976s21c1
Sequence:CCGGAGCACAGAGGAGCACCTAAAGCTCGAGCTTTAGGTGCTCCTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007210
GALNT6 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-178s1c1
Sequence:CCGGGCCATGAACAACCTTAGAGATCTCGAGATCTCTAAGGTTGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1443s1c1
Sequence:CCGGGCACAATGTCTACCCAGAGATCTCGAGATCTCTGGGTAGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-237s1c1
Sequence:CCGGGCAGACTCTGTTCTCCATAAACTCGAGTTTATGGAGAACAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1593s1c1
Sequence:CCGGCGGCAACCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007210.2-1107s1c1
Sequence:CCGGCGGTACCTATGATAATCAGATCTCGAGATCTGATTATCATAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007210.3-2269s21c1
Sequence:CCGGAGCTTCTCTGGAGGCCGTAAACTCGAGTTTACGGCCTCCAGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007210.3-976s21c1
Sequence:CCGGAGCACAGAGGAGCACCTAAAGCTCGAGCTTTAGGTGCTCCTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172451
GALNT6 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172451.1-2622s1c1
Sequence:CCGGCCTATGTCATTTGCACAGTTACTCGAGTAACTGTGCAAATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1980s1c1
Sequence:CCGGCGGCAATCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1000s1c1
Sequence:CCGGCCTGCCATCTTGCTGAATGAACTCGAGTTCATTCAGCAAGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1365s1c1
Sequence:CCGGCCTGACCTTCGGCTGGGAAATCTCGAGATTTCCCAGCCGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1488s1c1
Sequence:CCGGGCACATCGGTACCTATGATAACTCGAGTTATCATAGGTACCGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172451
GALNT6 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172451.1-2622s1c1
Sequence:CCGGCCTATGTCATTTGCACAGTTACTCGAGTAACTGTGCAAATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1980s1c1
Sequence:CCGGCGGCAATCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1000s1c1
Sequence:CCGGCCTGCCATCTTGCTGAATGAACTCGAGTTCATTCAGCAAGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1365s1c1
Sequence:CCGGCCTGACCTTCGGCTGGGAAATCTCGAGATTTCCCAGCCGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1488s1c1
Sequence:CCGGGCACATCGGTACCTATGATAACTCGAGTTATCATAGGTACCGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172451
GALNT6 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172451.1-2622s1c1
Sequence:CCGGCCTATGTCATTTGCACAGTTACTCGAGTAACTGTGCAAATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1980s1c1
Sequence:CCGGCGGCAATCAGTACTTTGAGTACTCGAGTACTCAAAGTACTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1000s1c1
Sequence:CCGGCCTGCCATCTTGCTGAATGAACTCGAGTTCATTCAGCAAGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1365s1c1
Sequence:CCGGCCTGACCTTCGGCTGGGAAATCTCGAGATTTCCCAGCCGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172451.1-1488s1c1
Sequence:CCGGGCACATCGGTACCTATGATAACTCGAGTTATCATAGGTACCGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks