EMAIL THIS PAGE TO A FRIEND

GALNT7

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)

51 Gene Product Result for
Synonyms: GALNAC-T7 GalNAcT7
UniProtKB ID: Q86SF2, B3KQU3, Q7Z5W7, Q9UJ28
Gene ID:
Human(51809) Summary: This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Mouse(108150) UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7
Rat(29750) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
domestic guinea pig(100724097) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
naked mole-rat(101709032) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
sheep(101113735) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Zebrafish(553668) UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7
chicken(422561) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
domestic cat(101091362) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
cow(524529) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
cow(100125773) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7
dog(486771) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017423 Rosetta Predictions human pricing
NM_022926 Rosetta Predictions rat pricing
NM_144731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236351 predicted 1263
2 SASI_Hs01_00236352 predicted 1432
3 SASI_Hs01_00236353 predicted 1735
4 SASI_Hs01_00236355 predicted 1062
5 SASI_Hs01_00236356 predicted 1425
6 SASI_Hs01_00236357 predicted 1051
7 SASI_Hs02_00349993 predicted 418
8 SASI_Hs01_00236358 predicted 318
9 SASI_Hs01_00236359 predicted 311
10 SASI_Hs01_00236360 predicted 696
11 SASI_Hs01_00236354 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030444 predicted 1221
2 SASI_Rn01_00030445 predicted 1031
3 SASI_Rn01_00030446 predicted 632
4 SASI_Rn02_00263619 predicted 1550
5 SASI_Rn01_00030447 predicted 1587
6 SASI_Rn01_00030448 predicted 271
7 SASI_Rn01_00030450 predicted 286
8 SASI_Rn01_00030451 predicted 556
9 SASI_Rn01_00030452 predicted 1451
10 SASI_Rn01_00030453 predicted 1655
11 SASI_Rn01_00030449 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105782 predicted 942
2 SASI_Mm01_00105783 predicted 612
3 SASI_Mm01_00105784 predicted 887
4 SASI_Mm01_00105785 predicted 1004
5 SASI_Mm01_00105786 predicted 729
6 SASI_Mm01_00105787 predicted 2075
7 SASI_Mm01_00105788 predicted 322
8 SASI_Mm01_00105789 predicted 264
9 SASI_Mm01_00105791 predicted 1630
10 SASI_Mm02_00340118 predicted 1879
11 SASI_Mm01_00105790 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144731
VALIDATED
GALNT7 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-603s21c1
Sequence:CCGGGCCAAGAAGAATGCAAGTATTCTCGAGAATACTTGCATTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-262s21c1
Sequence:CCGGAGTGGACTTAGAGTCTATTAGCTCGAGCTAATAGACTCTAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144731.3-2570s21c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-1641s21c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-827s21c1
Sequence:CCGGCTCGTGAAGGTATTTCGAAATCTCGAGATTTCGAAATACCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-995s21c1
Sequence:CCGGATTTGCACTGTGCCGATTATACTCGAGTATAATCGGCACAGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1642s1c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144731.2-1309s1c1
Sequence:CCGGGCAAATTGTTATTTGTGCCTTCTCGAGAAGGCACAAATAACAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1006s1c1
Sequence:CCGGTGCCGATTATAGATGTCATAACTCGAGTTATGACATCTATAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-644s1c1
Sequence:CCGGGCTTACTTCAAGCGTTGTCATCTCGAGATGACAACGCTTGAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-2571s1c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144731
VALIDATED
GALNT7 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-603s21c1
Sequence:CCGGGCCAAGAAGAATGCAAGTATTCTCGAGAATACTTGCATTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-262s21c1
Sequence:CCGGAGTGGACTTAGAGTCTATTAGCTCGAGCTAATAGACTCTAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144731.3-2570s21c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-1641s21c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-827s21c1
Sequence:CCGGCTCGTGAAGGTATTTCGAAATCTCGAGATTTCGAAATACCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-995s21c1
Sequence:CCGGATTTGCACTGTGCCGATTATACTCGAGTATAATCGGCACAGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1642s1c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144731.2-1309s1c1
Sequence:CCGGGCAAATTGTTATTTGTGCCTTCTCGAGAAGGCACAAATAACAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1006s1c1
Sequence:CCGGTGCCGATTATAGATGTCATAACTCGAGTTATGACATCTATAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-644s1c1
Sequence:CCGGGCTTACTTCAAGCGTTGTCATCTCGAGATGACAACGCTTGAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-2571s1c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144731
VALIDATED
GALNT7 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-603s21c1
Sequence:CCGGGCCAAGAAGAATGCAAGTATTCTCGAGAATACTTGCATTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-262s21c1
Sequence:CCGGAGTGGACTTAGAGTCTATTAGCTCGAGCTAATAGACTCTAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144731.3-2570s21c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-1641s21c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-827s21c1
Sequence:CCGGCTCGTGAAGGTATTTCGAAATCTCGAGATTTCGAAATACCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144731.3-995s21c1
Sequence:CCGGATTTGCACTGTGCCGATTATACTCGAGTATAATCGGCACAGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1642s1c1
Sequence:CCGGGCCTCGAAACTGCATACTGTACTCGAGTACAGTATGCAGTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144731.2-1309s1c1
Sequence:CCGGGCAAATTGTTATTTGTGCCTTCTCGAGAAGGCACAAATAACAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-1006s1c1
Sequence:CCGGTGCCGATTATAGATGTCATAACTCGAGTTATGACATCTATAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-644s1c1
Sequence:CCGGGCTTACTTCAAGCGTTGTCATCTCGAGATGACAACGCTTGAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144731.2-2571s1c1
Sequence:CCGGGCCTCTTTCATTTCTCAGTATCTCGAGATACTGAGAAATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017423
VALIDATED
GALNT7 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-1809s21c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1438s21c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1064s21c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-880s21c1
Sequence:CCGGATGGCCTAGTGAAGGTATTTCCTCGAGGAAATACCTTCACTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-2122s21c1
Sequence:CCGGCTGAAACCTGCTGCAACTATTCTCGAGAATAGTTGCAGCAGGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017423.1-1387s1c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1013s1c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-381s1c1
Sequence:CCGGCCTCAGACATTCACCTACCATCTCGAGATGGTAGGTGAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1871s1c1
Sequence:CCGGCCTGCACAGATTTACTCATATCTCGAGATATGAGTAAATCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1758s1c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017423
VALIDATED
GALNT7 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-1809s21c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1438s21c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1064s21c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-880s21c1
Sequence:CCGGATGGCCTAGTGAAGGTATTTCCTCGAGGAAATACCTTCACTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-2122s21c1
Sequence:CCGGCTGAAACCTGCTGCAACTATTCTCGAGAATAGTTGCAGCAGGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017423.1-1387s1c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1013s1c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-381s1c1
Sequence:CCGGCCTCAGACATTCACCTACCATCTCGAGATGGTAGGTGAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1871s1c1
Sequence:CCGGCCTGCACAGATTTACTCATATCTCGAGATATGAGTAAATCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1758s1c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017423
VALIDATED
GALNT7 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-1809s21c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1438s21c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-1064s21c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017423.2-880s21c1
Sequence:CCGGATGGCCTAGTGAAGGTATTTCCTCGAGGAAATACCTTCACTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017423.2-2122s21c1
Sequence:CCGGCTGAAACCTGCTGCAACTATTCTCGAGAATAGTTGCAGCAGGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017423.1-1387s1c1
Sequence:CCGGCGCCCATTTATGTTGGGTCTTCTCGAGAAGACCCAACATAAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1013s1c1
Sequence:CCGGGCCGCTTATAGATGTCATAAACTCGAGTTTATGACATCTATAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-381s1c1
Sequence:CCGGCCTCAGACATTCACCTACCATCTCGAGATGGTAGGTGAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1871s1c1
Sequence:CCGGCCTGCACAGATTTACTCATATCTCGAGATATGAGTAAATCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017423.1-1758s1c1
Sequence:CCGGGCAAATCAACTCATGCAGTATCTCGAGATACTGCATGAGTTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks