EMAIL THIS PAGE TO A FRIEND

GALNT8

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)

21 Gene Product Result for
Synonyms: GALNAC-T8
UniProtKB ID: Q9NY28, B2RU02
Gene ID:
Human(26290) Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. [provided by RefSeq, Jul 2008]
Zebrafish(100535692) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
dog(486734) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
cow(540652) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
sheep(101111708) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
Domestic Rabbit(100343562) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
naked mole-rat(101714390) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
domestic guinea pig(100718360) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150341 MISSION® esiRNA esiRNA human GALNT8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017417 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168052 predicted 798
2 SASI_Hs01_00168053 predicted 1448
3 SASI_Hs01_00168055 predicted 592
4 SASI_Hs02_00349982 predicted 289
5 SASI_Hs01_00168057 predicted 351
6 SASI_Hs01_00168058 predicted 1027
7 SASI_Hs01_00168059 predicted 1042
8 SASI_Hs01_00168060 predicted 1812
9 SASI_Hs01_00168061 predicted 1386
10 SASI_Hs02_00349983 predicted 1646
11 SASI_Hs01_00168054 predicted 1423
12 SASI_Hs01_00168056 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017417
GALNT8 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1113s1c1
Sequence:CCGGGCCTGGATTGATCTGCATGATCTCGAGATCATGCAGATCAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-150s1c1
Sequence:CCGGGCTGTCAATCTCCTTCTGGTACTCGAGTACCAGAAGGAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1409s1c1
Sequence:CCGGGCACAAACACATGGTCTACTTCTCGAGAAGTAGACCATGTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-927s1c1
Sequence:CCGGGCTCACATTGAAGTCAATGTTCTCGAGAACATTGACTTCAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-717s1c1
Sequence:CCGGCCCTCTCGATTGTTGAAGGAACTCGAGTTCCTTCAACAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-1276s21c1
Sequence:CCGGGTGGAGGGAAGGTCGAGATTTCTCGAGAAATCTCGACCTTCCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-788s21c1
Sequence:CCGCGGATGAGAAGATTAAGCTTTACTCGAGTAAAGCTTAATCTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017417
GALNT8 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1113s1c1
Sequence:CCGGGCCTGGATTGATCTGCATGATCTCGAGATCATGCAGATCAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-150s1c1
Sequence:CCGGGCTGTCAATCTCCTTCTGGTACTCGAGTACCAGAAGGAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1409s1c1
Sequence:CCGGGCACAAACACATGGTCTACTTCTCGAGAAGTAGACCATGTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-927s1c1
Sequence:CCGGGCTCACATTGAAGTCAATGTTCTCGAGAACATTGACTTCAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-717s1c1
Sequence:CCGGCCCTCTCGATTGTTGAAGGAACTCGAGTTCCTTCAACAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-1276s21c1
Sequence:CCGGGTGGAGGGAAGGTCGAGATTTCTCGAGAAATCTCGACCTTCCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-788s21c1
Sequence:CCGCGGATGAGAAGATTAAGCTTTACTCGAGTAAAGCTTAATCTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017417
GALNT8 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1113s1c1
Sequence:CCGGGCCTGGATTGATCTGCATGATCTCGAGATCATGCAGATCAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-150s1c1
Sequence:CCGGGCTGTCAATCTCCTTCTGGTACTCGAGTACCAGAAGGAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-1409s1c1
Sequence:CCGGGCACAAACACATGGTCTACTTCTCGAGAAGTAGACCATGTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-927s1c1
Sequence:CCGGGCTCACATTGAAGTCAATGTTCTCGAGAACATTGACTTCAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017417.1-717s1c1
Sequence:CCGGCCCTCTCGATTGTTGAAGGAACTCGAGTTCCTTCAACAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-1276s21c1
Sequence:CCGGGTGGAGGGAAGGTCGAGATTTCTCGAGAAATCTCGACCTTCCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017417.1-788s21c1
Sequence:CCGCGGATGAGAAGATTAAGCTTTACTCGAGTAAAGCTTAATCTTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks