EMAIL THIS PAGE TO A FRIEND

GALNT9

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)

80 Gene Product Result for
Synonyms: GALNAC-T9 GALNACT9
UniProtKB ID: Q9HCQ5, Q52LR8, Q6NT54, Q8NFR1
Gene ID:
Human(50614) Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(231605) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9
Rat(304571) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9
Zebrafish(797549) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
chicken(416796) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
cow(504951) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
domestic cat(101097673) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
dog(486224) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
domestic guinea pig(100718062) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
naked mole-rat(101719568) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
sheep(101117195) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122636 Rosetta Predictions human pricing
NM_021808 Rosetta Predictions human pricing
NM_001107151 Rosetta Predictions rat pricing
NM_001122644 Rosetta Predictions rat pricing
NM_001122639 Rosetta Predictions mouse pricing
NM_198306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327126 predicted 2381
2 SASI_Hs02_00327127 predicted 1682
3 SASI_Hs02_00327128 predicted 1525
4 SASI_Hs02_00327129 predicted 1474
5 SASI_Hs02_00327130 predicted 1496
6 SASI_Hs02_00327131 predicted 2021
7 SASI_Hs02_00327132 predicted 1731
8 SASI_Hs02_00327133 predicted 2372
9 SASI_Hs02_00327134 predicted 2386
10 SASI_Hs02_00327135 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233341 predicted 1443
2 SASI_Hs01_00233344 predicted 747
3 SASI_Hs01_00233345 predicted 590
4 SASI_Hs02_00355119 predicted 540
5 SASI_Hs01_00233346 predicted 561
6 SASI_Hs01_00233347 predicted 1090
7 SASI_Hs02_00355120 predicted 794
8 SASI_Hs01_00233348 predicted 1443
9 SASI_Hs01_00233349 predicted 1448
10 SASI_Hs01_00233350 predicted 794
11 SASI_Hs01_00233342 predicted 325
12 SASI_Hs01_00233343 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226005 predicted 592
2 SASI_Rn02_00226006 predicted 1150
3 SASI_Rn02_00226007 predicted 602
4 SASI_Rn02_00226008 predicted 641
5 SASI_Rn02_00226009 predicted 386
6 SASI_Rn02_00226010 predicted 1143
7 SASI_Rn02_00226011 predicted 569
8 SASI_Rn02_00226012 predicted 450
9 SASI_Rn02_00226013 predicted 712
10 SASI_Rn02_00226014 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252663 predicted 1908
2 SASI_Rn02_00252664 predicted 2470
3 SASI_Rn02_00252665 predicted 1914
4 SASI_Rn02_00252666 predicted 1951
5 SASI_Rn02_00252667 predicted 1701
6 SASI_Rn02_00252668 predicted 2457
7 SASI_Rn02_00252669 predicted 1882
8 SASI_Rn02_00252670 predicted 1766
9 SASI_Rn02_00252671 predicted 2027
10 SASI_Rn02_00252672 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309097 predicted 1305
2 SASI_Mm02_00309098 predicted 403
3 SASI_Mm02_00309099 predicted 1167
4 SASI_Mm02_00309100 predicted 737
5 SASI_Mm02_00309101 predicted 583
6 SASI_Mm02_00309102 predicted 620
7 SASI_Mm02_00309103 predicted 648
8 SASI_Mm02_00309104 predicted 792
9 SASI_Mm02_00309105 predicted 744
10 SASI_Mm02_00309106 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350937 predicted 2651
2 SASI_Mm02_00350938 predicted 1743
3 SASI_Mm02_00350939 predicted 2501
4 SASI_Mm01_00098520 predicted 2081
5 SASI_Mm01_00098521 predicted 1923
6 SASI_Mm01_00098522 predicted 1965
7 SASI_Mm01_00098523 predicted 1988
8 SASI_Mm01_00098524 predicted 2134
9 SASI_Mm01_00098525 predicted 2082
10 SASI_Mm01_00098526 predicted 2370
11 SASI_Mm01_00098527 predicted 220
12 SASI_Mm01_00098528 predicted 951
13 SASI_Mm01_00098529 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021808
GALNT9 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1470s21c1
Sequence:CCGGGCTCCTTGTGGTCTGGTAAGACTCGAGTCTTACCAGACCACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1446s21c1
Sequence:CCGGACCTAAGTCACACATCATAATCTCGAGATTATGATGTGTGACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-972s21c1
Sequence:CCGGATCAAACACGCACGGCACTGACTCGAGTCAGTGCCGTGCGTGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-570s21c1
Sequence:CCGGACGTACGGAGAGGTGAGAAACCTCGAGGTTTCTCACCTCTCCGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-536s1c1
Sequence:CCGGCCCGGAGATGAGGGTCTACAACTCGAGTTGTAGACCCTCATCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-326s1c1
Sequence:CCGGGCCCTACAACAACGACATTGACTCGAGTCAATGTCGTTGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-944s1c1
Sequence:CCGGGCAGAAGTGGATGATCAGAAACTCGAGTTTCTGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-344s1c1
Sequence:CCGGTGACTACTATGCCAAGCGCAACTCGAGTTGCGCTTGGCATAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021808
GALNT9 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1470s21c1
Sequence:CCGGGCTCCTTGTGGTCTGGTAAGACTCGAGTCTTACCAGACCACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1446s21c1
Sequence:CCGGACCTAAGTCACACATCATAATCTCGAGATTATGATGTGTGACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-972s21c1
Sequence:CCGGATCAAACACGCACGGCACTGACTCGAGTCAGTGCCGTGCGTGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-570s21c1
Sequence:CCGGACGTACGGAGAGGTGAGAAACCTCGAGGTTTCTCACCTCTCCGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-536s1c1
Sequence:CCGGCCCGGAGATGAGGGTCTACAACTCGAGTTGTAGACCCTCATCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-326s1c1
Sequence:CCGGGCCCTACAACAACGACATTGACTCGAGTCAATGTCGTTGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-944s1c1
Sequence:CCGGGCAGAAGTGGATGATCAGAAACTCGAGTTTCTGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-344s1c1
Sequence:CCGGTGACTACTATGCCAAGCGCAACTCGAGTTGCGCTTGGCATAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021808
GALNT9 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1470s21c1
Sequence:CCGGGCTCCTTGTGGTCTGGTAAGACTCGAGTCTTACCAGACCACAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021808.3-1446s21c1
Sequence:CCGGACCTAAGTCACACATCATAATCTCGAGATTATGATGTGTGACTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-972s21c1
Sequence:CCGGATCAAACACGCACGGCACTGACTCGAGTCAGTGCCGTGCGTGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021808.3-570s21c1
Sequence:CCGGACGTACGGAGAGGTGAGAAACCTCGAGGTTTCTCACCTCTCCGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-536s1c1
Sequence:CCGGCCCGGAGATGAGGGTCTACAACTCGAGTTGTAGACCCTCATCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-326s1c1
Sequence:CCGGGCCCTACAACAACGACATTGACTCGAGTCAATGTCGTTGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-944s1c1
Sequence:CCGGGCAGAAGTGGATGATCAGAAACTCGAGTTTCTGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021808.2-344s1c1
Sequence:CCGGTGACTACTATGCCAAGCGCAACTCGAGTTGCGCTTGGCATAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198306
GALNT9 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198306.1-980s1c1
Sequence:CCGGCCGCTTGTGTTCTGGTAACAACTCGAGTTGTTACCAGAACACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-422s1c1
Sequence:CCGGGCAGAAGTGGATGATCCGAAACTCGAGTTTCGGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-368s1c1
Sequence:CCGGGATGTCTAAAGATGCCAACTTCTCGAGAAGTTGGCATCTTTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-219s1c1
Sequence:CCGGGACTCCAAGTGTCTGGTAGATCTCGAGATCTACCAGACACTTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-216s1c1
Sequence:CCGGCCCGACTCCAAGTGTCTGGTACTCGAGTACCAGACACTTGGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198306
GALNT9 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198306.1-980s1c1
Sequence:CCGGCCGCTTGTGTTCTGGTAACAACTCGAGTTGTTACCAGAACACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-422s1c1
Sequence:CCGGGCAGAAGTGGATGATCCGAAACTCGAGTTTCGGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-368s1c1
Sequence:CCGGGATGTCTAAAGATGCCAACTTCTCGAGAAGTTGGCATCTTTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-219s1c1
Sequence:CCGGGACTCCAAGTGTCTGGTAGATCTCGAGATCTACCAGACACTTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-216s1c1
Sequence:CCGGCCCGACTCCAAGTGTCTGGTACTCGAGTACCAGACACTTGGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198306
GALNT9 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198306.1-980s1c1
Sequence:CCGGCCGCTTGTGTTCTGGTAACAACTCGAGTTGTTACCAGAACACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-422s1c1
Sequence:CCGGGCAGAAGTGGATGATCCGAAACTCGAGTTTCGGATCATCCACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-368s1c1
Sequence:CCGGGATGTCTAAAGATGCCAACTTCTCGAGAAGTTGGCATCTTTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-219s1c1
Sequence:CCGGGACTCCAAGTGTCTGGTAGATCTCGAGATCTACCAGACACTTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198306.1-216s1c1
Sequence:CCGGCCCGACTCCAAGTGTCTGGTACTCGAGTACCAGACACTTGGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks