EMAIL THIS PAGE TO A FRIEND

GALNTL5

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5

Synonyms: GALNACT19 GALNT15
UniProtKB ID: Q7Z4T8, Q75KN2, Q75MD3, Q8NCV4, Q8WW05, Q9UDR9
Gene ID:
Mouse(67909) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Rat(499968) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
dog(611040) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
cow(617031) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
domestic cat(101086384) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
sheep(101104903) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
naked mole-rat(101699282) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
domestic guinea pig(100715597) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145292 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145292 Rosetta Predictions human pricing
NM_001025148 Rosetta Predictions rat pricing
NM_026449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227719 predicted 456
2 SASI_Hs02_00365177 predicted 1443
3 SASI_Hs01_00227720 predicted 1194
4 SASI_Hs01_00227721 predicted 1058
5 SASI_Hs01_00227722 predicted 837
6 SASI_Hs02_00365178 predicted 1415
7 SASI_Hs01_00227725 predicted 1049
8 SASI_Hs02_00365179 predicted 1184
9 SASI_Hs01_00227726 predicted 547
10 SASI_Hs02_00365180 predicted 491
11 SASI_Hs01_00227723 predicted 522
12 SASI_Hs01_00227724 predicted 1134
13 SASI_Hs01_00227727 predicted 298
14 SASI_Hs01_00227728 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070674 predicted 1003
2 SASI_Rn01_00070675 predicted 865
3 SASI_Rn02_00203074 predicted 455
4 SASI_Rn01_00070676 predicted 832
5 SASI_Rn01_00070677 predicted 1204
6 SASI_Rn01_00070678 predicted 454
7 SASI_Rn01_00070679 predicted 634
8 SASI_Rn01_00070681 predicted 314
9 SASI_Rn02_00203075 predicted 1084
10 SASI_Rn01_00070683 predicted 998
11 SASI_Rn01_00070680 predicted 1022
12 SASI_Rn01_00070682 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111600 predicted 435
2 SASI_Mm02_00330283 predicted 864
3 SASI_Mm01_00111601 predicted 407
4 SASI_Mm01_00111602 predicted 516
5 SASI_Mm01_00111603 predicted 897
6 SASI_Mm01_00111604 predicted 418
7 SASI_Mm01_00111605 predicted 926
8 SASI_Mm01_00111607 predicted 1240
9 SASI_Mm01_00111608 predicted 675
10 SASI_Mm01_00111609 predicted 559
11 SASI_Mm01_00111606 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026449
GALNTL5 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1301s1c1
Sequence:CCGGGCTAGATGAATACAAGGGAAACTCGAGTTTCCCTTGTATTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-867s1c1
Sequence:CCGGGCCATTGCTAAGGATCACAAACTCGAGTTTGTGATCCTTAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1405s1c1
Sequence:CCGGGCAAGTCATTCCAGTGGTATTCTCGAGAATACCACTGGAATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-682s1c1
Sequence:CCGGTGAAGGACAAACTGGACTATTCTCGAGAATAGTCCAGTTTGTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-434s1c1
Sequence:CCGGGCGATATGGATTAAATGCCATCTCGAGATGGCATTTAATCCATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026449
GALNTL5 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1301s1c1
Sequence:CCGGGCTAGATGAATACAAGGGAAACTCGAGTTTCCCTTGTATTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-867s1c1
Sequence:CCGGGCCATTGCTAAGGATCACAAACTCGAGTTTGTGATCCTTAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1405s1c1
Sequence:CCGGGCAAGTCATTCCAGTGGTATTCTCGAGAATACCACTGGAATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-682s1c1
Sequence:CCGGTGAAGGACAAACTGGACTATTCTCGAGAATAGTCCAGTTTGTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-434s1c1
Sequence:CCGGGCGATATGGATTAAATGCCATCTCGAGATGGCATTTAATCCATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026449
GALNTL5 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1301s1c1
Sequence:CCGGGCTAGATGAATACAAGGGAAACTCGAGTTTCCCTTGTATTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-867s1c1
Sequence:CCGGGCCATTGCTAAGGATCACAAACTCGAGTTTGTGATCCTTAGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-1405s1c1
Sequence:CCGGGCAAGTCATTCCAGTGGTATTCTCGAGAATACCACTGGAATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-682s1c1
Sequence:CCGGTGAAGGACAAACTGGACTATTCTCGAGAATAGTCCAGTTTGTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026449.1-434s1c1
Sequence:CCGGGCGATATGGATTAAATGCCATCTCGAGATGGCATTTAATCCATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145292
GALNTL5 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1342s1c1
Sequence:CCGGCAGTGCTATGACACATAACTACTCGAGTAGTTATGTGTCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1456s1c1
Sequence:CCGGCGAGCGTGTTGAGTTAAGGAACTCGAGTTCCTTAACTCAACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-633s1c1
Sequence:CCGGGCATTGTCATTTGCTTCTATACTCGAGTATAGAAGCAAATGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1136s1c1
Sequence:CCGGCCTGCAATGTCTGGAGGAATTCTCGAGAATTCCTCCAGACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-494s1c1
Sequence:CCGGCCAGAACTTCATAAAGAACTTCTCGAGAAGTTCTTTATGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1096s21c1
Sequence:CCGGTTTGATTGGAACCTACAATTTCTCGAGAAATTGTAGGTTCCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1206s21c1
Sequence:CCGGTGCTATACGTCGGCATTATTTCTCGAGAAATAATGCCGACGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1339s21c1
Sequence:CCGGCGAGTAGGACATATCAGTAAGCTCGAGCTTACTGATATGTCCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1051s21c1
Sequence:CCGGGATAGAACTCTGGAGTATAAGCTCGAGCTTATACTCCAGAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145292
GALNTL5 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1342s1c1
Sequence:CCGGCAGTGCTATGACACATAACTACTCGAGTAGTTATGTGTCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1456s1c1
Sequence:CCGGCGAGCGTGTTGAGTTAAGGAACTCGAGTTCCTTAACTCAACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-633s1c1
Sequence:CCGGGCATTGTCATTTGCTTCTATACTCGAGTATAGAAGCAAATGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1136s1c1
Sequence:CCGGCCTGCAATGTCTGGAGGAATTCTCGAGAATTCCTCCAGACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-494s1c1
Sequence:CCGGCCAGAACTTCATAAAGAACTTCTCGAGAAGTTCTTTATGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1096s21c1
Sequence:CCGGTTTGATTGGAACCTACAATTTCTCGAGAAATTGTAGGTTCCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1206s21c1
Sequence:CCGGTGCTATACGTCGGCATTATTTCTCGAGAAATAATGCCGACGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1339s21c1
Sequence:CCGGCGAGTAGGACATATCAGTAAGCTCGAGCTTACTGATATGTCCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1051s21c1
Sequence:CCGGGATAGAACTCTGGAGTATAAGCTCGAGCTTATACTCCAGAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145292
GALNTL5 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1342s1c1
Sequence:CCGGCAGTGCTATGACACATAACTACTCGAGTAGTTATGTGTCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1456s1c1
Sequence:CCGGCGAGCGTGTTGAGTTAAGGAACTCGAGTTCCTTAACTCAACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-633s1c1
Sequence:CCGGGCATTGTCATTTGCTTCTATACTCGAGTATAGAAGCAAATGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-1136s1c1
Sequence:CCGGCCTGCAATGTCTGGAGGAATTCTCGAGAATTCCTCCAGACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145292.2-494s1c1
Sequence:CCGGCCAGAACTTCATAAAGAACTTCTCGAGAAGTTCTTTATGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1096s21c1
Sequence:CCGGTTTGATTGGAACCTACAATTTCTCGAGAAATTGTAGGTTCCAATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1206s21c1
Sequence:CCGGTGCTATACGTCGGCATTATTTCTCGAGAAATAATGCCGACGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1339s21c1
Sequence:CCGGCGAGTAGGACATATCAGTAAGCTCGAGCTTACTGATATGTCCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145292.3-1051s21c1
Sequence:CCGGGATAGAACTCTGGAGTATAAGCTCGAGCTTATACTCCAGAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks