EMAIL THIS PAGE TO A FRIEND

GALNTL6

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6

140 Gene Product Result for
Synonyms: GALNACT20 GALNT17
UniProtKB ID: Q49A17, Q2L4S6
Gene ID:
Mouse(270049) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Rat(361142) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
domestic guinea pig(100727667) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
naked mole-rat(101708443) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
sheep(101121150) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Domestic Rabbit(100355846) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
chicken(422560) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
cow(615819) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Horse(100061194) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
domestic cat(101089099) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
dog(486063) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034845 Rosetta Predictions human pricing
XM_926084 Rosetta Predictions human pricing
XM_001054513 Rosetta Predictions rat pricing
XM_341429 Rosetta Predictions rat pricing
NM_175032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146602 predicted 1071
2 SASI_Hs01_00146603 predicted 2408
3 SASI_Hs01_00146604 predicted 2038
4 SASI_Hs01_00146605 predicted 1166
5 SASI_Hs01_00146607 predicted 1041
6 SASI_Hs01_00146608 predicted 993
7 SASI_Hs01_00146609 predicted 1731
8 SASI_Hs01_00146611 predicted 2366
9 SASI_Hs02_00308147 predicted 2228
10 SASI_Hs02_00308148 predicted 1603
11 SASI_Hs01_00146606 predicted 1641
12 SASI_Hs01_00146610 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257723 predicted 1624
2 SASI_Hs01_00257724 predicted 2534
3 SASI_Hs01_00257725 predicted 1666
4 SASI_Hs01_00257726 predicted 2142
5 SASI_Hs01_00257727 predicted 2253
6 SASI_Hs01_00257728 predicted 2232
7 SASI_Hs01_00257729 predicted 2223
8 SASI_Hs01_00257730 predicted 2337
9 SASI_Hs01_00257731 predicted 1180
10 SASI_Hs01_00257732 predicted 2596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276097 predicted 1425
2 SASI_Rn02_00276098 predicted 1633
3 SASI_Rn02_00276099 predicted 703
4 SASI_Rn02_00276100 predicted 569
5 SASI_Rn02_00276101 predicted 783
6 SASI_Rn02_00276102 predicted 1226
7 SASI_Rn02_00276103 predicted 484
8 SASI_Rn02_00276104 predicted 850
9 SASI_Rn02_00276105 predicted 538
10 SASI_Rn02_00276106 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392902 predicted 1425
2 SASI_Rn02_00392903 predicted 1638
3 SASI_Rn02_00392904 predicted 701
4 SASI_Rn02_00392905 predicted 518
5 SASI_Rn02_00392906 predicted 569
6 SASI_Rn02_00392907 predicted 776
7 SASI_Rn02_00392908 predicted 1227
8 SASI_Rn02_00392909 predicted 485
9 SASI_Rn02_00392910 predicted 849
10 SASI_Rn02_00392911 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127309 predicted 384
2 SASI_Mm02_00345638 predicted 610
3 SASI_Mm01_00127310 predicted 568
4 SASI_Mm02_00345639 predicted 226
5 SASI_Mm01_00127311 predicted 653
6 SASI_Mm01_00127312 predicted 632
7 SASI_Mm01_00127313 predicted 515
8 SASI_Mm01_00127314 predicted 484
9 SASI_Mm01_00127316 predicted 572
10 SASI_Mm02_00345640 predicted 246
11 SASI_Mm01_00127307 predicted 447
12 SASI_Mm01_00127308 predicted 362
13 SASI_Mm01_00127315 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034845
GALNTL6 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2266s21c1
Sequence:CCGGGCCACTGCATACCCGGAAATTCTCGAGAATTTCCGGGTATGCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034845.2-2563s21c1
Sequence:CCGGGTGATTACCTACAGGTTATAACTCGAGTTATAACCTGTAGGTAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1813s21c1
Sequence:CCGGATGTTCTAGAGTTGGTCATATCTCGAGATATGACCAACTCTAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2368s21c1
Sequence:CCGGCCGGAAGGACAGAACATTATTCTCGAGAATAATGTTCTGTCCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1207s21c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1833s1c1
Sequence:CCGGGATGGATGAATTTGCCGAGTACTCGAGTACTCGGCAAATTCATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1033s1c1
Sequence:CCGGCGTCATGCTAACTGTAAGCATCTCGAGATGCTTACAGTTAGCATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034845
GALNTL6 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2266s21c1
Sequence:CCGGGCCACTGCATACCCGGAAATTCTCGAGAATTTCCGGGTATGCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034845.2-2563s21c1
Sequence:CCGGGTGATTACCTACAGGTTATAACTCGAGTTATAACCTGTAGGTAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1813s21c1
Sequence:CCGGATGTTCTAGAGTTGGTCATATCTCGAGATATGACCAACTCTAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2368s21c1
Sequence:CCGGCCGGAAGGACAGAACATTATTCTCGAGAATAATGTTCTGTCCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1207s21c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1833s1c1
Sequence:CCGGGATGGATGAATTTGCCGAGTACTCGAGTACTCGGCAAATTCATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1033s1c1
Sequence:CCGGCGTCATGCTAACTGTAAGCATCTCGAGATGCTTACAGTTAGCATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034845
GALNTL6 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2266s21c1
Sequence:CCGGGCCACTGCATACCCGGAAATTCTCGAGAATTTCCGGGTATGCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034845.2-2563s21c1
Sequence:CCGGGTGATTACCTACAGGTTATAACTCGAGTTATAACCTGTAGGTAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1813s21c1
Sequence:CCGGATGTTCTAGAGTTGGTCATATCTCGAGATATGACCAACTCTAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-2368s21c1
Sequence:CCGGCCGGAAGGACAGAACATTATTCTCGAGAATAATGTTCTGTCCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034845.2-1207s21c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1833s1c1
Sequence:CCGGGATGGATGAATTTGCCGAGTACTCGAGTACTCGGCAAATTCATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034845.1-1033s1c1
Sequence:CCGGCGTCATGCTAACTGTAAGCATCTCGAGATGCTTACAGTTAGCATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175032
GALNTL6 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175032.2-1069s21c1
Sequence:CCGGCCCTTTGAGTCTCCGGTTATGCTCGAGCATAACCGGAGACTCAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175032.1-734s1c1
Sequence:CCGGGCGGTTGTAATTGCACACCATCTCGAGATGGTGTGCAATTACAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-624s1c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-670s1c1
Sequence:CCGGGCAGAAATCATTCTAGTCGATCTCGAGATCGACTAGAATGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-577s1c1
Sequence:CCGGACCAGCATCATTATCCCATTTCTCGAGAAATGGGATAATGATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-531s1c1
Sequence:CCGGCCATGCCAACTGTAAGCACAACTCGAGTTGTGCTTACAGTTGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175032
GALNTL6 MISSION shRNA shRNA Plasmid DNA
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175032.2-1069s21c1
Sequence:CCGGCCCTTTGAGTCTCCGGTTATGCTCGAGCATAACCGGAGACTCAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175032.1-734s1c1
Sequence:CCGGGCGGTTGTAATTGCACACCATCTCGAGATGGTGTGCAATTACAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-624s1c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-670s1c1
Sequence:CCGGGCAGAAATCATTCTAGTCGATCTCGAGATCGACTAGAATGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-577s1c1
Sequence:CCGGACCAGCATCATTATCCCATTTCTCGAGAAATGGGATAATGATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-531s1c1
Sequence:CCGGCCATGCCAACTGTAAGCACAACTCGAGTTGTGCTTACAGTTGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175032
GALNTL6 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175032.2-1069s21c1
Sequence:CCGGCCCTTTGAGTCTCCGGTTATGCTCGAGCATAACCGGAGACTCAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175032.1-734s1c1
Sequence:CCGGGCGGTTGTAATTGCACACCATCTCGAGATGGTGTGCAATTACAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-624s1c1
Sequence:CCGGGCGGACCATACACAGTATAATCTCGAGATTATACTGTGTATGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-670s1c1
Sequence:CCGGGCAGAAATCATTCTAGTCGATCTCGAGATCGACTAGAATGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-577s1c1
Sequence:CCGGACCAGCATCATTATCCCATTTCTCGAGAAATGGGATAATGATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175032.1-531s1c1
Sequence:CCGGCCATGCCAACTGTAAGCACAACTCGAGTTGTGCTTACAGTTGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)