EMAIL THIS PAGE TO A FRIEND

GALP

galanin-like peptide

UniProtKB ID: Q9UBC7, A1KXL3
Gene ID:
Human(85569) Summary: This gene encodes a member of the galanin family of neuropeptides. The encoded protein binds galanin receptors 1, 2 and 3 with the highest affinity for galanin receptor 3 and has been implicated in biological processes involving the central nervous system including hypothalamic regulation of metabolism and reproduction. A peptide encoded by a splice variant of this gene, termed alarin, may have vasoactive properties and serve as a marker for neuroblastic tumors.[provided by RefSeq, Mar 2009]
Mouse(232836) galanin-like peptide
Rat(64568) galanin-like peptide
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033106 Rosetta Predictions human pricing
NM_022633 Rosetta Predictions rat pricing
NM_178028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044100 predicted 536
2 SASI_Hs01_00044101 predicted 694
3 SASI_Hs02_00360814 predicted 705
4 SASI_Hs01_00044102 predicted 631
5 SASI_Hs02_00360815 predicted 334
6 SASI_Hs01_00044104 predicted 538
7 SASI_Hs01_00044105 predicted 545
8 SASI_Hs01_00044106 predicted 327
9 SASI_Hs01_00044107 predicted 657
10 SASI_Hs01_00044108 predicted 701
11 SASI_Hs01_00044103 predicted 701
12 SASI_Hs01_00044109 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065012 predicted 290
2 SASI_Rn01_00065013 predicted 246
3 SASI_Rn01_00065014 predicted 217
4 SASI_Rn01_00065015 predicted 292
5 SASI_Rn01_00065016 predicted 250
6 SASI_Rn01_00065018 predicted 218
7 SASI_Rn01_00065019 predicted 276
8 SASI_Rn01_00065021 predicted 255
9 SASI_Rn02_00263421 predicted 255
10 SASI_Rn02_00263422 predicted 221
11 SASI_Rn01_00065017 predicted 218
12 SASI_Rn01_00065020 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078203 predicted 272
2 SASI_Mm01_00078204 predicted 348
3 SASI_Mm01_00078205 predicted 409
4 SASI_Mm01_00078206 predicted 358
5 SASI_Mm01_00078207 predicted 268
6 SASI_Mm01_00078208 predicted 412
7 SASI_Mm01_00078209 predicted 305
8 SASI_Mm01_00078210 predicted 272
9 SASI_Mm01_00078211 predicted 357
10 SASI_Mm01_00078212 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033106
GALP MISSION shRNA Bacterial Glycerol Stock
galanin-like peptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-333s1c1
Sequence:CCGGCCAAGAGGAATGTGATGGAGACTCGAGTCTCCATCACATTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-406s1c1
Sequence:CCGGCAAGGAGGAAGATGTCCTGAACTCGAGTTCAGGACATCTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-188s1c1
Sequence:CCGGCTCAATAGTGCTGGCTACCTTCTCGAGAAGGTAGCCAGCACTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-410s1c1
Sequence:CCGGGAGGAAGATGTCCTGAAGTCACTCGAGTGACTTCAGGACATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-759s1c1
Sequence:CCGGCGAGCTATTGCATAATACAAACTCGAGTTTGTATTATGCAATAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-514s1c1
Sequence:CCGGGAGACTAAGATCCTGAAGTTACTCGAGTAACTTCAGGATCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-361s1c1
Sequence:CCGGCAAACCAGAGATTGGAGATCTCTCGAGAGATCTCCAATCTCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-352s1c1
Sequence:CCGGGACGTTTGCCAAACCAGAGATCTCGAGATCTCTGGTTTGGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-190s1c1
Sequence:CCGGCAATAGTGCTGGCTACCTTCTCTCGAGAGAAGGTAGCCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-344s1c1
Sequence:CCGGGTGATGGAGACGTTTGCCAAACTCGAGTTTGGCAAACGTCTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-337s1c1
Sequence:CCGGGAGGAATGTGATGGAGACGTTCTCGAGAACGTCTCCATCACATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033106
GALP MISSION shRNA shRNA Plasmid DNA
galanin-like peptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-333s1c1
Sequence:CCGGCCAAGAGGAATGTGATGGAGACTCGAGTCTCCATCACATTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-406s1c1
Sequence:CCGGCAAGGAGGAAGATGTCCTGAACTCGAGTTCAGGACATCTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-188s1c1
Sequence:CCGGCTCAATAGTGCTGGCTACCTTCTCGAGAAGGTAGCCAGCACTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-410s1c1
Sequence:CCGGGAGGAAGATGTCCTGAAGTCACTCGAGTGACTTCAGGACATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-759s1c1
Sequence:CCGGCGAGCTATTGCATAATACAAACTCGAGTTTGTATTATGCAATAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-514s1c1
Sequence:CCGGGAGACTAAGATCCTGAAGTTACTCGAGTAACTTCAGGATCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-361s1c1
Sequence:CCGGCAAACCAGAGATTGGAGATCTCTCGAGAGATCTCCAATCTCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-352s1c1
Sequence:CCGGGACGTTTGCCAAACCAGAGATCTCGAGATCTCTGGTTTGGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-190s1c1
Sequence:CCGGCAATAGTGCTGGCTACCTTCTCTCGAGAGAAGGTAGCCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-344s1c1
Sequence:CCGGGTGATGGAGACGTTTGCCAAACTCGAGTTTGGCAAACGTCTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-337s1c1
Sequence:CCGGGAGGAATGTGATGGAGACGTTCTCGAGAACGTCTCCATCACATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033106
GALP MISSION shRNA Lentiviral Transduction Particles
galanin-like peptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-333s1c1
Sequence:CCGGCCAAGAGGAATGTGATGGAGACTCGAGTCTCCATCACATTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-406s1c1
Sequence:CCGGCAAGGAGGAAGATGTCCTGAACTCGAGTTCAGGACATCTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-188s1c1
Sequence:CCGGCTCAATAGTGCTGGCTACCTTCTCGAGAAGGTAGCCAGCACTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-410s1c1
Sequence:CCGGGAGGAAGATGTCCTGAAGTCACTCGAGTGACTTCAGGACATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-759s1c1
Sequence:CCGGCGAGCTATTGCATAATACAAACTCGAGTTTGTATTATGCAATAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033106.1-514s1c1
Sequence:CCGGGAGACTAAGATCCTGAAGTTACTCGAGTAACTTCAGGATCTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-361s1c1
Sequence:CCGGCAAACCAGAGATTGGAGATCTCTCGAGAGATCTCCAATCTCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-352s1c1
Sequence:CCGGGACGTTTGCCAAACCAGAGATCTCGAGATCTCTGGTTTGGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-190s1c1
Sequence:CCGGCAATAGTGCTGGCTACCTTCTCTCGAGAGAAGGTAGCCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-344s1c1
Sequence:CCGGGTGATGGAGACGTTTGCCAAACTCGAGTTTGGCAAACGTCTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033106.1-337s1c1
Sequence:CCGGGAGGAATGTGATGGAGACGTTCTCGAGAACGTCTCCATCACATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178028
GALP MISSION shRNA Bacterial Glycerol Stock
galanin-like peptide
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-439s1c1
Sequence:CCGGGACTCAGCTCTTGAGATCCTACTCGAGTAGGATCTCAAGAGCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-488s1c1
Sequence:CCGGCTTATTCCCACTCTCCAAGGACTCGAGTCCTTGGAGAGTGGGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-460s1c1
Sequence:CCGGGACCTGTGGAAGATCATTGATCTCGAGATCAATGATCTTCCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-369s1c1
Sequence:CCGGCAATAGTGCTGGTTACCTCCTCTCGAGAGGAGGTAACCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178028
GALP MISSION shRNA shRNA Plasmid DNA
galanin-like peptide
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-439s1c1
Sequence:CCGGGACTCAGCTCTTGAGATCCTACTCGAGTAGGATCTCAAGAGCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-488s1c1
Sequence:CCGGCTTATTCCCACTCTCCAAGGACTCGAGTCCTTGGAGAGTGGGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-460s1c1
Sequence:CCGGGACCTGTGGAAGATCATTGATCTCGAGATCAATGATCTTCCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-369s1c1
Sequence:CCGGCAATAGTGCTGGTTACCTCCTCTCGAGAGGAGGTAACCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178028
GALP MISSION shRNA Lentiviral Transduction Particles
galanin-like peptide
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-439s1c1
Sequence:CCGGGACTCAGCTCTTGAGATCCTACTCGAGTAGGATCTCAAGAGCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-488s1c1
Sequence:CCGGCTTATTCCCACTCTCCAAGGACTCGAGTCCTTGGAGAGTGGGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-460s1c1
Sequence:CCGGGACCTGTGGAAGATCATTGATCTCGAGATCAATGATCTTCCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178028.2-369s1c1
Sequence:CCGGCAATAGTGCTGGTTACCTCCTCTCGAGAGGAGGTAACCAGCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks