EMAIL THIS PAGE TO A FRIEND

GALR1

galanin receptor 1

72 Gene Product Result for
Synonyms: GALNR GALNR1
UniProtKB ID: P47211, Q4VBL7
Gene ID:
Human(2587) Summary: The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]
Mouse(14427) galanin receptor 1
Rat(50577) galanin receptor 1
Zebrafish(567820) galanin receptor 1
dog(483928) galanin receptor 1
cow(539429) galanin receptor 1
domestic cat(101100511) galanin receptor 1
chicken(428512) galanin receptor 1
domestic guinea pig(100730974) galanin receptor 1
naked mole-rat(101701792) galanin receptor 1
sheep(101123170) galanin receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001480 Rosetta Predictions human pricing
NM_012958 Rosetta Predictions rat pricing
NM_008082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105355 predicted 1563
2 SASI_Hs02_00331954 predicted 1551
3 SASI_Hs02_00331955 predicted 1629
4 SASI_Hs02_00331956 predicted 1525
5 SASI_Hs02_00331957 predicted 1157
6 SASI_Hs01_00105364 predicted 1544
7 SASI_Hs02_00331958 predicted 1230
8 SASI_Hs02_00331959 predicted 1373
9 SASI_Hs02_00331960 predicted 1460
10 SASI_Hs02_00331961 predicted 1232
11 SASI_Hs01_00105356 predicted 1908
12 SASI_Hs01_00105357 predicted 1885
13 SASI_Hs01_00105358 predicted 1377
14 SASI_Hs01_00105359 predicted 1160
15 SASI_Hs01_00105360 predicted 1746
16 SASI_Hs01_00105361 predicted 1433
17 SASI_Hs01_00105362 predicted 1427
18 SASI_Hs01_00105363 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260551 predicted 1589
2 SASI_Rn02_00260552 predicted 1367
3 SASI_Rn02_00260553 predicted 1402
4 SASI_Rn02_00260554 predicted 1123
5 SASI_Rn02_00260555 predicted 881
6 SASI_Rn02_00260556 predicted 1358
7 SASI_Rn02_00260557 predicted 1622
8 SASI_Rn02_00260558 predicted 1150
9 SASI_Rn02_00260559 predicted 1584
10 SASI_Rn02_00260560 predicted 1578
11 SASI_Rn01_00053954 predicted 247
12 SASI_Rn01_00053955 predicted 473
13 SASI_Rn01_00053956 predicted 347
14 SASI_Rn01_00053957 predicted 248
15 SASI_Rn01_00053958 predicted 349
16 SASI_Rn01_00053959 predicted 329
17 SASI_Rn01_00053960 predicted 320
18 SASI_Rn01_00053961 predicted 230
19 SASI_Rn01_00053962 predicted 334
20 SASI_Rn01_00053963 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313092 predicted 835
2 SASI_Mm02_00313093 predicted 1222
3 SASI_Mm02_00313094 predicted 1371
4 SASI_Mm02_00313095 predicted 1696
5 SASI_Mm02_00313096 predicted 1286
6 SASI_Mm02_00313097 predicted 1826
7 SASI_Mm02_00313098 predicted 832
8 SASI_Mm02_00313099 predicted 1763
9 SASI_Mm02_00313100 predicted 1281
10 SASI_Mm02_00313101 predicted 1218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001480
GALR1 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1796s1c1
Sequence:CCGGCCATCAACCAATTGTACTCATCTCGAGATGAGTACAATTGGTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1659s1c1
Sequence:CCGGCCTCCGTGAATCCTATCATTTCTCGAGAAATGATAGGATTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1093s1c1
Sequence:CCGGCTGCAAGTTCATCCACTACTTCTCGAGAAGTAGTGGATGAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1718s1c1
Sequence:CCGGCAAGTGTTCAAGTGTCACATTCTCGAGAATGTGACACTTGAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001480.2-2692s1c1
Sequence:CCGGGCGAGGTTGATGTAGATAATACTCGAGTATTATCTACATCAACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001480.3-2030s21c1
Sequence:CCGGTGGCCATTTACATAGACATATCTCGAGATATGTCTATGTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1473s21c1
Sequence:CCGGTCACACCTGAGTGATACTAAACTCGAGTTTAGTATCACTCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1152s21c1
Sequence:CCGGTGCTATGCCAAGGTCCTTAATCTCGAGATTAAGGACCTTGGCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001480
GALR1 MISSION shRNA shRNA Plasmid DNA
galanin receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1796s1c1
Sequence:CCGGCCATCAACCAATTGTACTCATCTCGAGATGAGTACAATTGGTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1659s1c1
Sequence:CCGGCCTCCGTGAATCCTATCATTTCTCGAGAAATGATAGGATTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1093s1c1
Sequence:CCGGCTGCAAGTTCATCCACTACTTCTCGAGAAGTAGTGGATGAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1718s1c1
Sequence:CCGGCAAGTGTTCAAGTGTCACATTCTCGAGAATGTGACACTTGAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001480.2-2692s1c1
Sequence:CCGGGCGAGGTTGATGTAGATAATACTCGAGTATTATCTACATCAACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001480.3-2030s21c1
Sequence:CCGGTGGCCATTTACATAGACATATCTCGAGATATGTCTATGTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1473s21c1
Sequence:CCGGTCACACCTGAGTGATACTAAACTCGAGTTTAGTATCACTCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1152s21c1
Sequence:CCGGTGCTATGCCAAGGTCCTTAATCTCGAGATTAAGGACCTTGGCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001480
GALR1 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1796s1c1
Sequence:CCGGCCATCAACCAATTGTACTCATCTCGAGATGAGTACAATTGGTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1659s1c1
Sequence:CCGGCCTCCGTGAATCCTATCATTTCTCGAGAAATGATAGGATTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1093s1c1
Sequence:CCGGCTGCAAGTTCATCCACTACTTCTCGAGAAGTAGTGGATGAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001480.2-1718s1c1
Sequence:CCGGCAAGTGTTCAAGTGTCACATTCTCGAGAATGTGACACTTGAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001480.2-2692s1c1
Sequence:CCGGGCGAGGTTGATGTAGATAATACTCGAGTATTATCTACATCAACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001480.3-2030s21c1
Sequence:CCGGTGGCCATTTACATAGACATATCTCGAGATATGTCTATGTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1473s21c1
Sequence:CCGGTCACACCTGAGTGATACTAAACTCGAGTTTAGTATCACTCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001480.3-1152s21c1
Sequence:CCGGTGCTATGCCAAGGTCCTTAATCTCGAGATTAAGGACCTTGGCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008082
GALR1 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1599s1c1
Sequence:CCGGAGTGTCATGTTTGCGATGAATCTCGAGATTCATCGCAAACATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-740s1c1
Sequence:CCGGGAGAACTTCATTACGCTGGTACTCGAGTACCAGCGTAATGAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-967s1c1
Sequence:CCGGCTGCAAGTTTATACACTACTTCTCGAGAAGTAGTGTATAAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1310s1c1
Sequence:CCGGGTCCTTAATCATCTGCATAAACTCGAGTTTATGCAGATGATTAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1397s1c1
Sequence:CCGGGTCGTTGTAGTATTTGGCATACTCGAGTATGCCAAATACTACAACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008082
GALR1 MISSION shRNA shRNA Plasmid DNA
galanin receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1599s1c1
Sequence:CCGGAGTGTCATGTTTGCGATGAATCTCGAGATTCATCGCAAACATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-740s1c1
Sequence:CCGGGAGAACTTCATTACGCTGGTACTCGAGTACCAGCGTAATGAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-967s1c1
Sequence:CCGGCTGCAAGTTTATACACTACTTCTCGAGAAGTAGTGTATAAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1310s1c1
Sequence:CCGGGTCCTTAATCATCTGCATAAACTCGAGTTTATGCAGATGATTAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1397s1c1
Sequence:CCGGGTCGTTGTAGTATTTGGCATACTCGAGTATGCCAAATACTACAACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008082
GALR1 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1599s1c1
Sequence:CCGGAGTGTCATGTTTGCGATGAATCTCGAGATTCATCGCAAACATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-740s1c1
Sequence:CCGGGAGAACTTCATTACGCTGGTACTCGAGTACCAGCGTAATGAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-967s1c1
Sequence:CCGGCTGCAAGTTTATACACTACTTCTCGAGAAGTAGTGTATAAACTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1310s1c1
Sequence:CCGGGTCCTTAATCATCTGCATAAACTCGAGTTTATGCAGATGATTAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008082.1-1397s1c1
Sequence:CCGGGTCGTTGTAGTATTTGGCATACTCGAGTATGCCAAATACTACAACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks