EMAIL THIS PAGE TO A FRIEND

GALR2

galanin receptor 2

49 Gene Product Result for
Synonyms: GAL2-R GALNR2 GALR-2
UniProtKB ID: O43603, A5JUU4, Q32MN8
Gene ID:
Human(8811) Summary: Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
Mouse(14428) galanin receptor 2
Rat(29234) galanin receptor 2
sheep(101118117) galanin receptor 2
naked mole-rat(101706932) galanin receptor 2
chicken(770030) galanin receptor 2
domestic cat(101096429) galanin receptor 2
cow(618629) galanin receptor 2
Horse(100051251) galanin receptor 2
dog(483325) galanin receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138931 MISSION® esiRNA esiRNA human GALR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003857 Rosetta Predictions human pricing
NM_019172 Rosetta Predictions rat pricing
NM_010254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014974 predicted 837
2 SASI_Hs01_00014975 predicted 879
3 SASI_Hs02_00336437 predicted 354
4 SASI_Hs01_00014976 predicted 960
5 SASI_Hs01_00014977 predicted 774
6 SASI_Hs01_00014979 predicted 440
7 SASI_Hs01_00014980 predicted 978
8 SASI_Hs01_00014981 predicted 978
9 SASI_Hs01_00014982 predicted 352
10 SASI_Hs01_00014983 predicted 667
11 SASI_Hs01_00014978 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094210 predicted 568
2 SASI_Rn01_00094211 predicted 606
3 SASI_Rn01_00094212 predicted 908
4 SASI_Rn01_00094213 predicted 772
5 SASI_Rn01_00094214 predicted 719
6 SASI_Rn01_00094215 predicted 414
7 SASI_Rn01_00094216 predicted 895
8 SASI_Rn01_00094217 predicted 817
9 SASI_Rn01_00094218 predicted 383
10 SASI_Rn01_00094219 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051259 predicted 1640
2 SASI_Mm01_00051260 predicted 1686
3 SASI_Mm02_00318149 predicted 1644
4 SASI_Mm01_00051262 predicted 1297
5 SASI_Mm01_00051264 predicted 1234
6 SASI_Mm01_00051265 predicted 1356
7 SASI_Mm01_00051266 predicted 805
8 SASI_Mm01_00051267 predicted 937
9 SASI_Mm01_00051263 predicted 1171
10 SASI_Mm01_00051268 predicted 1346
11 SASI_Mm01_00051261 predicted 1543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003857
GALR2 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-964s21c1
Sequence:CCGGGTCTCCAAGCACTTCCGCAAACTCGAGTTTGCGGAAGTGCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-249s21c1
Sequence:CCGGGGTCAGCACTACCAACCTGTTCTCGAGAACAGGTTGGTAGTGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-885s1c1
Sequence:CCGGCGCCACTTATGCGCTTCGCATCTCGAGATGCGAAGCGCATAAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-168s1c1
Sequence:CCGGCCTGCTCTTCGCGCTCATCTTCTCGAGAAGATGAGCGCGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-243s1c1
Sequence:CCGGCCAGGCGGTCAGCACTACCAACTCGAGTTGGTAGTGCTGACCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-1089s1c1
Sequence:CCGGGCGCGAGTCCAGCGACCTGTTCTCGAGAACAGGTCGCTGGACTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-774s1c1
Sequence:CCGGGCGCAAGGTGACACGCATGATCTCGAGATCATGCGTGTCACCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003857
GALR2 MISSION shRNA shRNA Plasmid DNA
galanin receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-964s21c1
Sequence:CCGGGTCTCCAAGCACTTCCGCAAACTCGAGTTTGCGGAAGTGCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-249s21c1
Sequence:CCGGGGTCAGCACTACCAACCTGTTCTCGAGAACAGGTTGGTAGTGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-885s1c1
Sequence:CCGGCGCCACTTATGCGCTTCGCATCTCGAGATGCGAAGCGCATAAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-168s1c1
Sequence:CCGGCCTGCTCTTCGCGCTCATCTTCTCGAGAAGATGAGCGCGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-243s1c1
Sequence:CCGGCCAGGCGGTCAGCACTACCAACTCGAGTTGGTAGTGCTGACCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-1089s1c1
Sequence:CCGGGCGCGAGTCCAGCGACCTGTTCTCGAGAACAGGTCGCTGGACTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-774s1c1
Sequence:CCGGGCGCAAGGTGACACGCATGATCTCGAGATCATGCGTGTCACCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003857
GALR2 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-964s21c1
Sequence:CCGGGTCTCCAAGCACTTCCGCAAACTCGAGTTTGCGGAAGTGCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003857.2-249s21c1
Sequence:CCGGGGTCAGCACTACCAACCTGTTCTCGAGAACAGGTTGGTAGTGCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-885s1c1
Sequence:CCGGCGCCACTTATGCGCTTCGCATCTCGAGATGCGAAGCGCATAAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-168s1c1
Sequence:CCGGCCTGCTCTTCGCGCTCATCTTCTCGAGAAGATGAGCGCGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-243s1c1
Sequence:CCGGCCAGGCGGTCAGCACTACCAACTCGAGTTGGTAGTGCTGACCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-1089s1c1
Sequence:CCGGGCGCGAGTCCAGCGACCTGTTCTCGAGAACAGGTCGCTGGACTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003857.2-774s1c1
Sequence:CCGGGCGCAAGGTGACACGCATGATCTCGAGATCATGCGTGTCACCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010254
GALR2 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1432s1c1
Sequence:CCGGCCAAGCATTTCCGCAAAGGTTCTCGAGAACCTTTGCGGAAATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1621s1c1
Sequence:CCGGCCAACTGCACAACCTTGAGTACTCGAGTACTCAAGGTTGTGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1366s1c1
Sequence:CCGGGCATCCTTTCACATCTAGTATCTCGAGATACTAGATGTGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-796s1c1
Sequence:CCGGCCATCTATACCCTGGACGATTCTCGAGAATCGTCCAGGGTATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-722s1c1
Sequence:CCGGCACGAACCTATTCATCCTCAACTCGAGTTGAGGATGAATAGGTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010254
GALR2 MISSION shRNA shRNA Plasmid DNA
galanin receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1432s1c1
Sequence:CCGGCCAAGCATTTCCGCAAAGGTTCTCGAGAACCTTTGCGGAAATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1621s1c1
Sequence:CCGGCCAACTGCACAACCTTGAGTACTCGAGTACTCAAGGTTGTGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1366s1c1
Sequence:CCGGGCATCCTTTCACATCTAGTATCTCGAGATACTAGATGTGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-796s1c1
Sequence:CCGGCCATCTATACCCTGGACGATTCTCGAGAATCGTCCAGGGTATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-722s1c1
Sequence:CCGGCACGAACCTATTCATCCTCAACTCGAGTTGAGGATGAATAGGTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010254
GALR2 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1432s1c1
Sequence:CCGGCCAAGCATTTCCGCAAAGGTTCTCGAGAACCTTTGCGGAAATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1621s1c1
Sequence:CCGGCCAACTGCACAACCTTGAGTACTCGAGTACTCAAGGTTGTGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-1366s1c1
Sequence:CCGGGCATCCTTTCACATCTAGTATCTCGAGATACTAGATGTGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-796s1c1
Sequence:CCGGCCATCTATACCCTGGACGATTCTCGAGAATCGTCCAGGGTATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010254.2-722s1c1
Sequence:CCGGCACGAACCTATTCATCCTCAACTCGAGTTGAGGATGAATAGGTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks