EMAIL THIS PAGE TO A FRIEND

GALR3

galanin receptor 3

UniProtKB ID: O60755, Q53YJ4
Gene ID:
Human(8484) Summary: The neuropeptide galanin modulates a variety of physiologic processes including cognition/memory, sensory/pain processing, hormone secretion, and feeding behavior. The human galanin receptors are G protein-coupled receptors that functionally couple to their intracellular effector through distinct signaling pathways. GALR3 is found in many tissues and may be expressed as 1.4-, 2.4-, and 5-kb transcripts [provided by RefSeq, Jul 2008]
Mouse(14429) galanin receptor 3
Rat(29235) galanin receptor 3
chicken(427904) galanin receptor 3
cow(788463) galanin receptor 3
dog(610233) galanin receptor 3
domestic guinea pig(100732575) galanin receptor 3
naked mole-rat(101724288) galanin receptor 3
sheep(101119389) galanin receptor 3
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003614 Rosetta Predictions human pricing
NM_019173 Rosetta Predictions rat pricing
NM_015738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013774 predicted 213
2 SASI_Hs01_00013776 predicted 211
3 SASI_Hs01_00013777 predicted 311
4 SASI_Hs01_00013778 predicted 363
5 SASI_Hs01_00013779 predicted 213
6 SASI_Hs01_00013780 predicted 353
7 SASI_Hs01_00013781 predicted 271
8 SASI_Hs01_00013782 predicted 418
9 SASI_Hs01_00013783 predicted 410
10 SASI_Hs02_00335952 predicted 423
11 SASI_Hs01_00013775 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042917 predicted 334
2 SASI_Rn01_00042918 predicted 309
3 SASI_Rn01_00042919 predicted 742
4 SASI_Rn02_00261962 predicted 810
5 SASI_Rn01_00042920 predicted 304
6 SASI_Rn01_00042922 predicted 872
7 SASI_Rn01_00042923 predicted 822
8 SASI_Rn01_00042924 predicted 584
9 SASI_Rn01_00042925 predicted 580
10 SASI_Rn01_00042926 predicted 306
11 SASI_Rn01_00042921 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323064 predicted 613
2 SASI_Mm02_00323065 predicted 330
3 SASI_Mm01_00166771 predicted 337
4 SASI_Mm02_00323066 predicted 540
5 SASI_Mm01_00166772 predicted 282
6 SASI_Mm01_00166773 predicted 330
7 SASI_Mm01_00166774 predicted 451
8 SASI_Mm01_00166775 predicted 559
9 SASI_Mm02_00323067 predicted 197
10 SASI_Mm01_00166778 predicted 455
11 SASI_Mm01_00166776 predicted 346
12 SASI_Mm01_00166777 predicted 459
13 SASI_Mm01_00166779 predicted 285
14 SASI_Mm01_00166780 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015738
VALIDATED
GALR3 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-863s1c1
Sequence:CCGGCGCTCGTCTATTCCCTTGCCTCTCGAGAGGCAAGGGAATAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015738.1-60s1c1
Sequence:CCGGGCCGGTGGTCTTTGCCCTCATCTCGAGATGAGGGCAAAGACCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-840s1c1
Sequence:CCGGCTACGCCAACTCCTGCCTCAACTCGAGTTGAGGCAGGAGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-238s1c1
Sequence:CCGGGCGGCCATCTACACACTGGATCTCGAGATCCAGTGTGTAGATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-301s1c1
Sequence:CCGGCTCATCTACCTCACCATGTATCTCGAGATACATGGTGAGGTAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015738
VALIDATED
GALR3 MISSION shRNA shRNA Plasmid DNA
galanin receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-863s1c1
Sequence:CCGGCGCTCGTCTATTCCCTTGCCTCTCGAGAGGCAAGGGAATAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015738.1-60s1c1
Sequence:CCGGGCCGGTGGTCTTTGCCCTCATCTCGAGATGAGGGCAAAGACCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-840s1c1
Sequence:CCGGCTACGCCAACTCCTGCCTCAACTCGAGTTGAGGCAGGAGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-238s1c1
Sequence:CCGGGCGGCCATCTACACACTGGATCTCGAGATCCAGTGTGTAGATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-301s1c1
Sequence:CCGGCTCATCTACCTCACCATGTATCTCGAGATACATGGTGAGGTAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015738
VALIDATED
GALR3 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-863s1c1
Sequence:CCGGCGCTCGTCTATTCCCTTGCCTCTCGAGAGGCAAGGGAATAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015738.1-60s1c1
Sequence:CCGGGCCGGTGGTCTTTGCCCTCATCTCGAGATGAGGGCAAAGACCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-840s1c1
Sequence:CCGGCTACGCCAACTCCTGCCTCAACTCGAGTTGAGGCAGGAGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-238s1c1
Sequence:CCGGGCGGCCATCTACACACTGGATCTCGAGATCCAGTGTGTAGATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015738.1-301s1c1
Sequence:CCGGCTCATCTACCTCACCATGTATCTCGAGATACATGGTGAGGTAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003614
GALR3 MISSION shRNA Bacterial Glycerol Stock
galanin receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-858s1c1
Sequence:CCGGGCCTGGCCTACGCCAACTCCTCTCGAGAGGAGTTGGCGTAGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-219s1c1
Sequence:CCGGCGGTGGCTGACCTCTGCTTCACTCGAGTGAAGCAGAGGTCAGCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-301s1c1
Sequence:CCGGCCTCGTCTGCAAGGCCGTGCACTCGAGTGCACGGCCTTGCAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-876s1c1
Sequence:CCGGCCTGCCTCAACCCGCTCGTCTCTCGAGAGACGAGCGGGTTGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-87s1c1
Sequence:CCGGCTGTGGTCTTTGCCCTAATCTCTCGAGAGATTAGGGCAAAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-187s21c1
Sequence:CCGGCAGCACCACGGACCTGTTCATCTCGAGATGAACAGGTCCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-102s21c1
Sequence:CCGGTAATCTTCCTGCTGGGCACAGCTCGAGCTGTGCCCAGCAGGAAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-786s21c1
Sequence:CCGGTCATCCTGTGCTTCTGGTACGCTCGAGCGTACCAGAAGCACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-85s21c1
Sequence:CCGGGCCTGTGGTCTTTGCCCTAATCTCGAGATTAGGGCAAAGACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003614
GALR3 MISSION shRNA shRNA Plasmid DNA
galanin receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-858s1c1
Sequence:CCGGGCCTGGCCTACGCCAACTCCTCTCGAGAGGAGTTGGCGTAGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-219s1c1
Sequence:CCGGCGGTGGCTGACCTCTGCTTCACTCGAGTGAAGCAGAGGTCAGCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-301s1c1
Sequence:CCGGCCTCGTCTGCAAGGCCGTGCACTCGAGTGCACGGCCTTGCAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-876s1c1
Sequence:CCGGCCTGCCTCAACCCGCTCGTCTCTCGAGAGACGAGCGGGTTGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-87s1c1
Sequence:CCGGCTGTGGTCTTTGCCCTAATCTCTCGAGAGATTAGGGCAAAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-187s21c1
Sequence:CCGGCAGCACCACGGACCTGTTCATCTCGAGATGAACAGGTCCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-102s21c1
Sequence:CCGGTAATCTTCCTGCTGGGCACAGCTCGAGCTGTGCCCAGCAGGAAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-786s21c1
Sequence:CCGGTCATCCTGTGCTTCTGGTACGCTCGAGCGTACCAGAAGCACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-85s21c1
Sequence:CCGGGCCTGTGGTCTTTGCCCTAATCTCGAGATTAGGGCAAAGACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003614
GALR3 MISSION shRNA Lentiviral Transduction Particles
galanin receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-858s1c1
Sequence:CCGGGCCTGGCCTACGCCAACTCCTCTCGAGAGGAGTTGGCGTAGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-219s1c1
Sequence:CCGGCGGTGGCTGACCTCTGCTTCACTCGAGTGAAGCAGAGGTCAGCCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-301s1c1
Sequence:CCGGCCTCGTCTGCAAGGCCGTGCACTCGAGTGCACGGCCTTGCAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-876s1c1
Sequence:CCGGCCTGCCTCAACCCGCTCGTCTCTCGAGAGACGAGCGGGTTGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003614.1-87s1c1
Sequence:CCGGCTGTGGTCTTTGCCCTAATCTCTCGAGAGATTAGGGCAAAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-187s21c1
Sequence:CCGGCAGCACCACGGACCTGTTCATCTCGAGATGAACAGGTCCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-102s21c1
Sequence:CCGGTAATCTTCCTGCTGGGCACAGCTCGAGCTGTGCCCAGCAGGAAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-786s21c1
Sequence:CCGGTCATCCTGTGCTTCTGGTACGCTCGAGCGTACCAGAAGCACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003614.1-85s21c1
Sequence:CCGGGCCTGTGGTCTTTGCCCTAATCTCGAGATTAGGGCAAAGACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks