EMAIL THIS PAGE TO A FRIEND

GALT

galactose-1-phosphate uridylyltransferase

55 Gene Product Result for
Gene ID:
Human(2592) Summary: Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(14430) galactose-1-phosphate uridyl transferase
Rat(298003) galactose-1-phosphate uridylyltransferase
sheep(101120986) galactose-1-phosphate uridylyltransferase
naked mole-rat(101708590) galactose-1-phosphate uridylyltransferase
domestic guinea pig(100726560) galactose-1-phosphate uridylyltransferase
Zebrafish(791130) galactose-1-phosphate uridylyltransferase
cow(506997) galactose-1-phosphate uridylyltransferase
domestic cat(101085503) galactose-1-phosphate uridylyltransferase
dog(474751) galactose-1-phosphate uridylyltransferase
chicken(431509) galactose-1-phosphate uridylyltransferase
fruit fly(33935) Galactose-1-phosphate uridylyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000155 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000155 Rosetta Predictions human pricing
NM_001013089 Rosetta Predictions rat pricing
NM_016658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204371 predicted 762
2 SASI_Hs01_00204372 predicted 745
3 SASI_Hs01_00204373 predicted 675
4 SASI_Hs01_00204374 predicted 1060
5 SASI_Hs01_00204375 predicted 912
6 SASI_Hs01_00204376 predicted 757
7 SASI_Hs01_00204377 predicted 329
8 SASI_Hs01_00204378 predicted 652
9 SASI_Hs01_00204379 predicted 419
10 SASI_Hs01_00204380 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103270 predicted 1065
2 SASI_Rn01_00103271 predicted 769
3 SASI_Rn01_00103272 predicted 629
4 SASI_Rn02_00200731 predicted 753
5 SASI_Rn01_00103274 predicted 655
6 SASI_Rn01_00103276 predicted 704
7 SASI_Rn01_00103277 predicted 637
8 SASI_Rn01_00103278 predicted 920
9 SASI_Rn01_00103279 predicted 669
10 SASI_Rn02_00200732 predicted 762
11 SASI_Rn01_00103273 predicted 565
12 SASI_Rn01_00103275 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106787 predicted 1161
2 SASI_Mm02_00323259 predicted 1310
3 SASI_Mm02_00323260 predicted 1130
4 SASI_Mm01_00106790 predicted 935
5 SASI_Mm01_00106791 predicted 1161
6 SASI_Mm02_00323261 predicted 1315
7 SASI_Mm01_00106793 predicted 1162
8 SASI_Mm02_00323262 predicted 1322
9 SASI_Mm02_00323263 predicted 1125
10 SASI_Mm01_00106795 predicted 1305
11 SASI_Mm01_00106788 predicted 886
12 SASI_Mm01_00106789 predicted 1064
13 SASI_Mm01_00106792 predicted 888
14 SASI_Mm01_00106794 predicted 888
15 SASI_Mm01_00106796 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016658
VALIDATED
GALT MISSION shRNA Bacterial Glycerol Stock
galactose-1-phosphate uridylyltransferase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016658.2-1590s21c1
Sequence:CCGGACTCTTACATTCCGGAGTTTGCTCGAGCAAACTCCGGAATGTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1302s21c1
Sequence:CCGGATCCGCAACTGTCCGGAAGTTCTCGAGAACTTCCGGACAGTTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1374s21c1
Sequence:CCGGACAGGCCGCAGAAAGATTAAGCTCGAGCTTAATCTTTCTGCGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1397s21c1
Sequence:CCGGCGCTTCCCGAGGTACACTATTCTCGAGAATAGTGTACCTCGGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1169s21c1
Sequence:CCGGCCAAGTACGACAATCTATTTGCTCGAGCAAATAGATTGTCGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-812s21c1
Sequence:CCGGACCCTTGGGTGCAGATCTTTGCTCGAGCAAAGATCTGCACCCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1194s1c1
Sequence:CCGGCCAGAAAGATTAAGGGCGCTTCTCGAGAAGCGCCCTTAATCTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-915s1c1
Sequence:CCGGCTCTTGACCAAGTACGACAATCTCGAGATTGTCGTACTTGGTCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1137s1c1
Sequence:CCGGGCAACTGTCTATGAAATGCTTCTCGAGAAGCATTTCATAGACAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-440s1c1
Sequence:CCGGCAGAGGAGTTTGTAAGGTCATCTCGAGATGACCTTACAAACTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-720s1c1
Sequence:CCGGCCTTTGTTATTGGAATATGGTCTCGAGACCATATTCCAATAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016658
VALIDATED
GALT MISSION shRNA shRNA Plasmid DNA
galactose-1-phosphate uridylyltransferase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016658.2-1590s21c1
Sequence:CCGGACTCTTACATTCCGGAGTTTGCTCGAGCAAACTCCGGAATGTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1302s21c1
Sequence:CCGGATCCGCAACTGTCCGGAAGTTCTCGAGAACTTCCGGACAGTTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1374s21c1
Sequence:CCGGACAGGCCGCAGAAAGATTAAGCTCGAGCTTAATCTTTCTGCGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1397s21c1
Sequence:CCGGCGCTTCCCGAGGTACACTATTCTCGAGAATAGTGTACCTCGGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1169s21c1
Sequence:CCGGCCAAGTACGACAATCTATTTGCTCGAGCAAATAGATTGTCGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-812s21c1
Sequence:CCGGACCCTTGGGTGCAGATCTTTGCTCGAGCAAAGATCTGCACCCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1194s1c1
Sequence:CCGGCCAGAAAGATTAAGGGCGCTTCTCGAGAAGCGCCCTTAATCTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-915s1c1
Sequence:CCGGCTCTTGACCAAGTACGACAATCTCGAGATTGTCGTACTTGGTCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1137s1c1
Sequence:CCGGGCAACTGTCTATGAAATGCTTCTCGAGAAGCATTTCATAGACAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-440s1c1
Sequence:CCGGCAGAGGAGTTTGTAAGGTCATCTCGAGATGACCTTACAAACTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-720s1c1
Sequence:CCGGCCTTTGTTATTGGAATATGGTCTCGAGACCATATTCCAATAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016658
VALIDATED
GALT MISSION shRNA Lentiviral Transduction Particles
galactose-1-phosphate uridylyltransferase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016658.2-1590s21c1
Sequence:CCGGACTCTTACATTCCGGAGTTTGCTCGAGCAAACTCCGGAATGTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1302s21c1
Sequence:CCGGATCCGCAACTGTCCGGAAGTTCTCGAGAACTTCCGGACAGTTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1374s21c1
Sequence:CCGGACAGGCCGCAGAAAGATTAAGCTCGAGCTTAATCTTTCTGCGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1397s21c1
Sequence:CCGGCGCTTCCCGAGGTACACTATTCTCGAGAATAGTGTACCTCGGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-1169s21c1
Sequence:CCGGCCAAGTACGACAATCTATTTGCTCGAGCAAATAGATTGTCGTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016658.2-812s21c1
Sequence:CCGGACCCTTGGGTGCAGATCTTTGCTCGAGCAAAGATCTGCACCCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1194s1c1
Sequence:CCGGCCAGAAAGATTAAGGGCGCTTCTCGAGAAGCGCCCTTAATCTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-915s1c1
Sequence:CCGGCTCTTGACCAAGTACGACAATCTCGAGATTGTCGTACTTGGTCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016658.1-1137s1c1
Sequence:CCGGGCAACTGTCTATGAAATGCTTCTCGAGAAGCATTTCATAGACAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-440s1c1
Sequence:CCGGCAGAGGAGTTTGTAAGGTCATCTCGAGATGACCTTACAAACTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016658.1-720s1c1
Sequence:CCGGCCTTTGTTATTGGAATATGGTCTCGAGACCATATTCCAATAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000155
VALIDATED
GALT MISSION shRNA Bacterial Glycerol Stock
galactose-1-phosphate uridylyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-767s21c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-910s21c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-638s21c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-1063s21c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-151s21c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-151s1c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-767s1c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-638s1c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-1063s1c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-910s1c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000155
VALIDATED
GALT MISSION shRNA shRNA Plasmid DNA
galactose-1-phosphate uridylyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-767s21c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-910s21c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-638s21c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-1063s21c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-151s21c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-151s1c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-767s1c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-638s1c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-1063s1c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-910s1c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000155
VALIDATED
GALT MISSION shRNA Lentiviral Transduction Particles
galactose-1-phosphate uridylyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-767s21c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-910s21c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-638s21c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-1063s21c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000155.2-151s21c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-151s1c1
Sequence:CCGGCCATCAGCATATCCGCTACAACTCGAGTTGTAGCGGATATGCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-767s1c1
Sequence:CCGGCTAACCAGTGAGCACTGGTTACTCGAGTAACCAGTGCTCACTGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000155.2-638s1c1
Sequence:CCGGGCCAGCAGTTTCCTGCCAGATCTCGAGATCTGGCAGGAAACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-1063s1c1
Sequence:CCGGCCGGAAATTCATGGTTGGCTACTCGAGTAGCCAACCATGAATTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000155.2-910s1c1
Sequence:CCGGGCTCTTGACCAAGTATGACAACTCGAGTTGTCATACTTGGTCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)