EMAIL THIS PAGE TO A FRIEND

GAMT

guanidinoacetate N-methyltransferase

59 Gene Product Result for
Synonyms: CCDS2 PIG2 TP53I2
UniProtKB ID: Q14353, A8K0A0, Q53Y34, Q8WVJ1
Gene ID:
Human(2593) Summary: The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]
Mouse(14431) guanidinoacetate methyltransferase
Rat(25257) guanidinoacetate N-methyltransferase
Zebrafish(796865) guanidinoacetate N-methyltransferase
cow(515270) guanidinoacetate N-methyltransferase
domestic cat(101096703) guanidinoacetate N-methyltransferase
dog(485085) guanidinoacetate N-methyltransferase
chicken(770737) guanidinoacetate N-methyltransferase
domestic guinea pig(100735222) guanidinoacetate N-methyltransferase
naked mole-rat(101701700) guanidinoacetate N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000156 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120131 MISSION® esiRNA esiRNA human GAMT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000156 Rosetta Predictions human pricing
NM_138924 Rosetta Predictions human pricing
NM_012793 Rosetta Predictions rat pricing
NM_010255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068859 predicted 621
2 SASI_Hs01_00068860 predicted 510
3 SASI_Hs01_00068861 predicted 315
4 SASI_Hs01_00068862 predicted 317
5 SASI_Hs01_00068863 predicted 736
6 SASI_Hs01_00068864 predicted 683
7 SASI_Hs01_00068865 predicted 191
8 SASI_Hs01_00068866 predicted 326
9 SASI_Hs01_00068867 predicted 878
10 SASI_Hs02_00301972 predicted 942
11 SASI_Hs01_00068868 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122758 predicted 509
2 SASI_Hs01_00122759 predicted 504
3 SASI_Hs01_00122760 predicted 622
4 SASI_Hs01_00122761 predicted 313
5 SASI_Hs01_00122762 predicted 769
6 SASI_Hs01_00122763 predicted 768
7 SASI_Hs01_00122764 predicted 317
8 SASI_Hs01_00122765 predicted 194
9 SASI_Hs01_00122766 predicted 321
10 SASI_Hs01_00122767 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260217 predicted 443
2 SASI_Rn01_00074396 predicted 538
3 SASI_Rn01_00074397 predicted 433
4 SASI_Rn01_00074398 predicted 504
5 SASI_Rn01_00074400 predicted 416
6 SASI_Rn01_00074401 predicted 595
7 SASI_Rn01_00074402 predicted 436
8 SASI_Rn01_00074403 predicted 365
9 SASI_Rn01_00074404 predicted 430
10 SASI_Rn01_00074405 predicted 290
11 SASI_Rn01_00074399 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189634 predicted 346
2 SASI_Mm01_00189636 predicted 496
3 SASI_Mm01_00189637 predicted 319
4 SASI_Mm01_00189638 predicted 467
5 SASI_Mm01_00189639 predicted 316
6 SASI_Mm01_00189641 predicted 448
7 SASI_Mm01_00189643 predicted 553
8 SASI_Mm02_00318150 predicted 444
9 SASI_Mm02_00318151 predicted 457
10 SASI_Mm01_00189635 predicted 501
11 SASI_Mm01_00189640 predicted 354
12 SASI_Mm01_00189642 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010255
VALIDATED
GAMT MISSION shRNA Bacterial Glycerol Stock
guanidinoacetate N-methyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-500s1c1
Sequence:CCGGTGGGATTCTATATGACACGTACTCGAGTACGTGTCATATAGAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-644s1c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-354s1c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-545s1c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-492s1c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-311s21c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-449s21c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-502s21c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-601s21c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010255
VALIDATED
GAMT MISSION shRNA shRNA Plasmid DNA
guanidinoacetate N-methyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-500s1c1
Sequence:CCGGTGGGATTCTATATGACACGTACTCGAGTACGTGTCATATAGAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-644s1c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-354s1c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-545s1c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-492s1c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-311s21c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-449s21c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-502s21c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-601s21c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010255
VALIDATED
GAMT MISSION shRNA Lentiviral Transduction Particles
guanidinoacetate N-methyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-500s1c1
Sequence:CCGGTGGGATTCTATATGACACGTACTCGAGTACGTGTCATATAGAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-644s1c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-354s1c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-545s1c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010255.1-492s1c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-311s21c1
Sequence:CCGGCCCATAGAGGAACACTGGATTCTCGAGAATCCAGTGTTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-449s21c1
Sequence:CCGGCACTTTGATGGGATTCTATATCTCGAGATATAGAATCCCATCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-502s21c1
Sequence:CCGGCACTCACCAGTTCAACTTTATCTCGAGATAAAGTTGAACTGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010255.3-601s21c1
Sequence:CCGGGAAGTCCAAATACACAGACATCTCGAGATGTCTGTGTATTTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000156
VALIDATED
GAMT MISSION shRNA Bacterial Glycerol Stock
guanidinoacetate N-methyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-876s1c1
Sequence:CCGGCCCAGCTGTGTGTCACCAGAACTCGAGTTCTGGTGACACACAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-332s1c1
Sequence:CCGGGCATTGGATCATCGAGTGCAACTCGAGTTGCACTCGATGATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-518s1c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-320s1c1
Sequence:CCGGGCCCATTGATGAGCATTGGATCTCGAGATCCAATGCTCATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-623s1c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-745s21c1
Sequence:CCGGACGCCTTCCCACAGATGATCACTCGAGTGATCATCTGTGGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-288s21c1
Sequence:CCGGATGGCCATCGCAGCGTCAAAGCTCGAGCTTTGACGCTGCGATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-518s21c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-623s21c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000156
VALIDATED
GAMT MISSION shRNA shRNA Plasmid DNA
guanidinoacetate N-methyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-876s1c1
Sequence:CCGGCCCAGCTGTGTGTCACCAGAACTCGAGTTCTGGTGACACACAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-332s1c1
Sequence:CCGGGCATTGGATCATCGAGTGCAACTCGAGTTGCACTCGATGATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-518s1c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-320s1c1
Sequence:CCGGGCCCATTGATGAGCATTGGATCTCGAGATCCAATGCTCATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-623s1c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-745s21c1
Sequence:CCGGACGCCTTCCCACAGATGATCACTCGAGTGATCATCTGTGGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-288s21c1
Sequence:CCGGATGGCCATCGCAGCGTCAAAGCTCGAGCTTTGACGCTGCGATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-518s21c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-623s21c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000156
VALIDATED
GAMT MISSION shRNA Lentiviral Transduction Particles
guanidinoacetate N-methyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-876s1c1
Sequence:CCGGCCCAGCTGTGTGTCACCAGAACTCGAGTTCTGGTGACACACAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-332s1c1
Sequence:CCGGGCATTGGATCATCGAGTGCAACTCGAGTTGCACTCGATGATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-518s1c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-320s1c1
Sequence:CCGGGCCCATTGATGAGCATTGGATCTCGAGATCCAATGCTCATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000156.4-623s1c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-745s21c1
Sequence:CCGGACGCCTTCCCACAGATGATCACTCGAGTGATCATCTGTGGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-288s21c1
Sequence:CCGGATGGCCATCGCAGCGTCAAAGCTCGAGCTTTGACGCTGCGATGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-518s21c1
Sequence:CCGGCCAGTTCAACTTCATCAAGAACTCGAGTTCTTGATGAAGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000156.4-623s21c1
Sequence:CCGGCTCAGACATCACCATCATGTTCTCGAGAACATGATGGTGATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks