EMAIL THIS PAGE TO A FRIEND

GAMTP1

guanidinoacetate N-methyltransferase pseudogene 1

Gene Product Result for
Synonyms: GAMTP
Species: Human GAMTP1(391491)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372973
GAMTP1 MISSION shRNA Bacterial Glycerol Stock
guanidinoacetate N-methyltransferase pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-90s1c1
Sequence:CCGGACACTGGATCATGGAGTGCAACTCGAGTTGCACTCCATGATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-45s1c1
Sequence:CCGGCATGGCCACAAGAATATGGAACTCGAGTTCCATATTCTTGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-80s1c1
Sequence:CCGGCCATCCAGGAACACTGGATCACTCGAGTGATCCAGTGTTCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-100s1c1
Sequence:CCGGATGGAGTGCAATGACAGCATCCTCGAGGATGCTGTCATTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-38s1c1
Sequence:CCGGGCTTCGGCATGGCCACAAGAACTCGAGTTCTTGTGGCCATGCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372973
GAMTP1 MISSION shRNA shRNA Plasmid DNA
guanidinoacetate N-methyltransferase pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-90s1c1
Sequence:CCGGACACTGGATCATGGAGTGCAACTCGAGTTGCACTCCATGATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-45s1c1
Sequence:CCGGCATGGCCACAAGAATATGGAACTCGAGTTCCATATTCTTGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-80s1c1
Sequence:CCGGCCATCCAGGAACACTGGATCACTCGAGTGATCCAGTGTTCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-100s1c1
Sequence:CCGGATGGAGTGCAATGACAGCATCCTCGAGGATGCTGTCATTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-38s1c1
Sequence:CCGGGCTTCGGCATGGCCACAAGAACTCGAGTTCTTGTGGCCATGCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372973
GAMTP1 MISSION shRNA Lentiviral Transduction Particles
guanidinoacetate N-methyltransferase pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-90s1c1
Sequence:CCGGACACTGGATCATGGAGTGCAACTCGAGTTGCACTCCATGATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-45s1c1
Sequence:CCGGCATGGCCACAAGAATATGGAACTCGAGTTCCATATTCTTGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-80s1c1
Sequence:CCGGCCATCCAGGAACACTGGATCACTCGAGTGATCCAGTGTTCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-100s1c1
Sequence:CCGGATGGAGTGCAATGACAGCATCCTCGAGGATGCTGTCATTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372973.1-38s1c1
Sequence:CCGGGCTTCGGCATGGCCACAAGAACTCGAGTTCTTGTGGCCATGCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks