EMAIL THIS PAGE TO A FRIEND

GAN

gigaxonin

184 Gene Product Result for
Synonyms: GAN1 KLHL16
UniProtKB ID: Q9H2C0
Gene ID:
Human(8139) Summary: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
Mouse(209239) giant axonal neuropathy
Rat(307893) gigaxonin
chicken(430553) gigaxonin
cow(521175) gigaxonin
Horse(100069891) gigaxonin
dog(489694) gigaxonin
sheep(101121287) gigaxonin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022041 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022041 Rosetta Predictions human pricing
NM_001107434 Rosetta Predictions rat pricing
NM_001081151 Rosetta Predictions mouse pricing
XM_146539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217960 predicted 1898
2 SASI_Hs01_00217961 predicted 364
3 SASI_Hs02_00355386 predicted 1708
4 SASI_Hs01_00217962 predicted 1073
5 SASI_Hs01_00217963 predicted 1217
6 SASI_Hs01_00217964 predicted 690
7 SASI_Hs01_00217965 predicted 1174
8 SASI_Hs02_00355387 predicted 584
9 SASI_Hs01_00217966 predicted 1247
10 SASI_Hs01_00217967 predicted 1351
11 SASI_Hs01_00217959 predicted 884
12 SASI_Hs01_00217968 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228785 predicted 342
2 SASI_Rn02_00228786 predicted 652
3 SASI_Rn02_00228787 predicted 1575
4 SASI_Rn02_00228788 predicted 1588
5 SASI_Rn02_00228789 predicted 1593
6 SASI_Rn02_00228790 predicted 302
7 SASI_Rn02_00228791 predicted 1666
8 SASI_Rn02_00228792 predicted 1673
9 SASI_Rn02_00228793 predicted 1206
10 SASI_Rn02_00228794 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295681 predicted 1498
2 SASI_Mm02_00295682 predicted 1570
3 SASI_Mm02_00295683 predicted 1404
4 SASI_Mm02_00295684 predicted 642
5 SASI_Mm02_00295685 predicted 228
6 SASI_Mm02_00295686 predicted 204
7 SASI_Mm02_00295687 predicted 1214
8 SASI_Mm02_00295688 predicted 909
9 SASI_Mm02_00295689 predicted 1355
10 SASI_Mm02_00295690 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230975 predicted 249
2 SASI_Mm01_00230976 predicted 207
3 SASI_Mm01_00230977 predicted 649
4 SASI_Mm01_00230978 predicted 220
5 SASI_Mm01_00230979 predicted 1174
6 SASI_Mm01_00230980 predicted 228
7 SASI_Mm01_00230981 predicted 1214
8 SASI_Mm01_00230982 predicted 533
9 SASI_Mm01_00230983 predicted 922
10 SASI_Mm01_00230984 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022041
GAN MISSION shRNA Bacterial Glycerol Stock
gigaxonin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022041.2-4332s1c1
Sequence:CCGGCCACATAATATGGGATGCAATCTCGAGATTGCATCCCATATTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1343s1c1
Sequence:CCGGCCTGGACAAAGCAACCTGATTCTCGAGAATCAGGTTGCTTTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-555s1c1
Sequence:CCGGCCGTGACTTTGCACTACATTACTCGAGTAATGTAGTGCAAAGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1231s1c1
Sequence:CCGGGCAAGACATAACTTCGGAATTCTCGAGAATTCCGAAGTTATGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-300s1c1
Sequence:CCGGCCCGTACATCAGGACAAAGTTCTCGAGAACTTTGTCCTGATGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-859s21c1
Sequence:CCGGTGAACCATTAGTACGAGAAATCTCGAGATTTCTCGTACTAATGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-377s21c1
Sequence:CCGGGGGATATCGGTAATGGTTATGCTCGAGCATAACCATTACCGATATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022041
GAN MISSION shRNA shRNA Plasmid DNA
gigaxonin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022041.2-4332s1c1
Sequence:CCGGCCACATAATATGGGATGCAATCTCGAGATTGCATCCCATATTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1343s1c1
Sequence:CCGGCCTGGACAAAGCAACCTGATTCTCGAGAATCAGGTTGCTTTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-555s1c1
Sequence:CCGGCCGTGACTTTGCACTACATTACTCGAGTAATGTAGTGCAAAGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1231s1c1
Sequence:CCGGGCAAGACATAACTTCGGAATTCTCGAGAATTCCGAAGTTATGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-300s1c1
Sequence:CCGGCCCGTACATCAGGACAAAGTTCTCGAGAACTTTGTCCTGATGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-859s21c1
Sequence:CCGGTGAACCATTAGTACGAGAAATCTCGAGATTTCTCGTACTAATGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-377s21c1
Sequence:CCGGGGGATATCGGTAATGGTTATGCTCGAGCATAACCATTACCGATATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022041
GAN MISSION shRNA Lentiviral Transduction Particles
gigaxonin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022041.2-4332s1c1
Sequence:CCGGCCACATAATATGGGATGCAATCTCGAGATTGCATCCCATATTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1343s1c1
Sequence:CCGGCCTGGACAAAGCAACCTGATTCTCGAGAATCAGGTTGCTTTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-555s1c1
Sequence:CCGGCCGTGACTTTGCACTACATTACTCGAGTAATGTAGTGCAAAGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-1231s1c1
Sequence:CCGGGCAAGACATAACTTCGGAATTCTCGAGAATTCCGAAGTTATGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022041.2-300s1c1
Sequence:CCGGCCCGTACATCAGGACAAAGTTCTCGAGAACTTTGTCCTGATGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-859s21c1
Sequence:CCGGTGAACCATTAGTACGAGAAATCTCGAGATTTCTCGTACTAATGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022041.3-377s21c1
Sequence:CCGGGGGATATCGGTAATGGTTATGCTCGAGCATAACCATTACCGATATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081151
GAN MISSION shRNA Bacterial Glycerol Stock
gigaxonin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-274s21c1
Sequence:CCGGAGTGGGCAGATCAGGTTAAATCTCGAGATTTAACCTGATCTGCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1622s21c1
Sequence:CCGGACGACTACGTGCGGGAGTTTACTCGAGTAAACTCCCGCACGTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1149s21c1
Sequence:CCGGTGGCGATCGAGAGCTCATTTCCTCGAGGAAATGAGCTCTCGATCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081151.1-2278s21c1
Sequence:CCGGGCAGTTAGTTCCCACTTATTACTCGAGTAATAAGTGGGAACTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081151
GAN MISSION shRNA shRNA Plasmid DNA
gigaxonin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-274s21c1
Sequence:CCGGAGTGGGCAGATCAGGTTAAATCTCGAGATTTAACCTGATCTGCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1622s21c1
Sequence:CCGGACGACTACGTGCGGGAGTTTACTCGAGTAAACTCCCGCACGTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1149s21c1
Sequence:CCGGTGGCGATCGAGAGCTCATTTCCTCGAGGAAATGAGCTCTCGATCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081151.1-2278s21c1
Sequence:CCGGGCAGTTAGTTCCCACTTATTACTCGAGTAATAAGTGGGAACTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081151
GAN MISSION shRNA Lentiviral Transduction Particles
gigaxonin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-274s21c1
Sequence:CCGGAGTGGGCAGATCAGGTTAAATCTCGAGATTTAACCTGATCTGCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1622s21c1
Sequence:CCGGACGACTACGTGCGGGAGTTTACTCGAGTAAACTCCCGCACGTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081151.1-1149s21c1
Sequence:CCGGTGGCGATCGAGAGCTCATTTCCTCGAGGAAATGAGCTCTCGATCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081151.1-2278s21c1
Sequence:CCGGGCAGTTAGTTCCCACTTATTACTCGAGTAATAAGTGGGAACTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)