EMAIL THIS PAGE TO A FRIEND

GANAB

glucosidase, alpha; neutral AB

140 Gene Product Result for
Synonyms: G2AN GLUII
UniProtKB ID: Q14697, A6NC20, Q8WTS9, Q9P0X0
Gene ID:
Mouse(14376) alpha glucosidase 2 alpha neutral subunit
Rat(293721) glucosidase, alpha; neutral AB
Zebrafish(100334730) glucosidase, alpha; neutral AB
dog(483784) glucosidase, alpha; neutral AB
domestic cat(101089297) glucosidase, alpha; neutral AB
cow(540155) glucosidase, alpha; neutral AB
Horse(100060146) glucosidase, alpha; neutral AB
domestic guinea pig(100731374) glucosidase, alpha; neutral AB
naked mole-rat(101720326) glucosidase, alpha; neutral AB
sheep(101111759) glucosidase, alpha; neutral AB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198334 Rosetta Predictions human pricing
NM_198335 Rosetta Predictions human pricing
NM_001106334 Rosetta Predictions rat pricing
NM_008060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120816 predicted 2901
2 SASI_Hs01_00120817 predicted 2350
3 SASI_Hs01_00120818 predicted 2525
4 SASI_Hs02_00371882 predicted 1195
5 SASI_Hs01_00120821 predicted 858
6 SASI_Hs01_00120822 predicted 1156
7 SASI_Hs01_00120823 predicted 238
8 SASI_Hs01_00120824 predicted 938
9 SASI_Hs02_00371883 predicted 1911
10 SASI_Hs01_00120825 predicted 2023
11 SASI_Hs01_00120819 predicted 2853
12 SASI_Hs01_00120820 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211831 predicted 2967
2 SASI_Hs01_00211832 predicted 2422
3 SASI_Hs01_00211833 predicted 2593
4 SASI_Hs02_00371884 predicted 1265
5 SASI_Hs01_00211836 predicted 916
6 SASI_Hs01_00211837 predicted 1222
7 SASI_Hs01_00211838 predicted 244
8 SASI_Hs01_00211839 predicted 1008
9 SASI_Hs02_00371885 predicted 1973
10 SASI_Hs01_00211840 predicted 2094
11 SASI_Hs01_00211834 predicted 2912
12 SASI_Hs01_00211835 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217948 predicted 1654
2 SASI_Rn02_00217949 predicted 1355
3 SASI_Rn02_00217950 predicted 2394
4 SASI_Rn02_00217951 predicted 1064
5 SASI_Rn02_00217952 predicted 2906
6 SASI_Rn02_00217953 predicted 2889
7 SASI_Rn02_00217954 predicted 1769
8 SASI_Rn02_00217955 predicted 2880
9 SASI_Rn02_00217956 predicted 2996
10 SASI_Rn02_00217957 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063782 predicted 1336
2 SASI_Mm01_00063783 predicted 220
3 SASI_Mm01_00063784 predicted 2220
4 SASI_Mm01_00063785 predicted 2892
5 SASI_Mm01_00063787 predicted 2843
6 SASI_Mm01_00063788 predicted 529
7 SASI_Mm01_00063789 predicted 1746
8 SASI_Mm01_00063790 predicted 2404
9 SASI_Mm02_00313049 predicted 1027
10 SASI_Mm01_00063791 predicted 2991
11 SASI_Mm01_00063786 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008060
VALIDATED
GANAB MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; neutral AB
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2328s21c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-605s21c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008060.1-2994s21c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2719s21c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2994s1c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008060.1-2719s1c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-1654s1c1
Sequence:CCGGGCTTTGACAATTATGAGGGTTCTCGAGAACCCTCATAATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2328s1c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-605s1c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008060
VALIDATED
GANAB MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; neutral AB
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2328s21c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-605s21c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008060.1-2994s21c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2719s21c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2994s1c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008060.1-2719s1c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-1654s1c1
Sequence:CCGGGCTTTGACAATTATGAGGGTTCTCGAGAACCCTCATAATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2328s1c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-605s1c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008060
VALIDATED
GANAB MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; neutral AB
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2328s21c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-605s21c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008060.1-2994s21c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008060.1-2719s21c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2994s1c1
Sequence:CCGGCCTAGATTTCACCTTCTAATTCTCGAGAATTAGAAGGTGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008060.1-2719s1c1
Sequence:CCGGGCCACCTTGAGACACCTATTTCTCGAGAAATAGGTGTCTCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-1654s1c1
Sequence:CCGGGCTTTGACAATTATGAGGGTTCTCGAGAACCCTCATAATTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-2328s1c1
Sequence:CCGGGCACTCCTTATTCACCCTGTACTCGAGTACAGGGTGAATAAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008060.1-605s1c1
Sequence:CCGGCGTGTGGGATAAGATCAAGAACTCGAGTTCTTGATCTTATCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198334
GANAB MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198334.1-2907s21c1
Sequence:CCGGCATTAGTGCTGAGAGATATTCCTCGAGGAATATCTCTCAGCACTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-2406s21c1
Sequence:CCGGGTACCTGCCTGTAACTCTAAGCTCGAGCTTAGAGTTACAGGCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1636s21c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-127s21c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1329s21c1
Sequence:CCGGTGCTGATGGCAAGCGGTATTTCTCGAGAAATACCGCTTGCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198334
GANAB MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198334.1-2907s21c1
Sequence:CCGGCATTAGTGCTGAGAGATATTCCTCGAGGAATATCTCTCAGCACTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-2406s21c1
Sequence:CCGGGTACCTGCCTGTAACTCTAAGCTCGAGCTTAGAGTTACAGGCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1636s21c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-127s21c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1329s21c1
Sequence:CCGGTGCTGATGGCAAGCGGTATTTCTCGAGAAATACCGCTTGCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198334
GANAB MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198334.1-2907s21c1
Sequence:CCGGCATTAGTGCTGAGAGATATTCCTCGAGGAATATCTCTCAGCACTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-2406s21c1
Sequence:CCGGGTACCTGCCTGTAACTCTAAGCTCGAGCTTAGAGTTACAGGCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1636s21c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-127s21c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198334.1-1329s21c1
Sequence:CCGGTGCTGATGGCAAGCGGTATTTCTCGAGAAATACCGCTTGCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014610
VALIDATED
GANAB MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-367s1c1
Sequence:CCGGCGATACCGTGTACCAGATGTTCTCGAGAACATCTGGTACACGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-1702s1c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-2208s1c1
Sequence:CCGGGCGATATTCTTTGCTGCCCTTCTCGAGAAGGGCAGCAAAGAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-127s1c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-1812s1c1
Sequence:CCGGGCATAACATCTATGGCCTTTACTCGAGTAAAGGCCATAGATGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014610
VALIDATED
GANAB MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-367s1c1
Sequence:CCGGCGATACCGTGTACCAGATGTTCTCGAGAACATCTGGTACACGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-1702s1c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-2208s1c1
Sequence:CCGGGCGATATTCTTTGCTGCCCTTCTCGAGAAGGGCAGCAAAGAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-127s1c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-1812s1c1
Sequence:CCGGGCATAACATCTATGGCCTTTACTCGAGTAAAGGCCATAGATGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014610
VALIDATED
GANAB MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; neutral AB
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-367s1c1
Sequence:CCGGCGATACCGTGTACCAGATGTTCTCGAGAACATCTGGTACACGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-1702s1c1
Sequence:CCGGCCCAACCTCTTTGTCTGGAATCTCGAGATTCCAGACAAAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-2208s1c1
Sequence:CCGGGCGATATTCTTTGCTGCCCTTCTCGAGAAGGGCAGCAAAGAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014610.3-127s1c1
Sequence:CCGGGCTGTGGATAGAAGCAACTTTCTCGAGAAAGTTGCTTCTATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014610.3-1812s1c1
Sequence:CCGGGCATAACATCTATGGCCTTTACTCGAGTAAAGGCCATAGATGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks