EMAIL THIS PAGE TO A FRIEND

GAP43

growth associated protein 43

101 Gene Product Result for
Synonyms: B-50 PP46
UniProtKB ID: P17677, A8K0Y4
Gene ID:
Human(2596) Summary: The protein encoded by this gene has been termed a 'growth' or 'plasticity' protein because it is expressed at high levels in neuronal growth cones during development and axonal regeneration. This protein is considered a crucial component of an effective regenerative response in the nervous system. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14432) growth associated protein 43
Rat(29423) growth associated protein 43
Zebrafish(30608) growth associated protein 43
chicken(427955) growth associated protein 43
domestic cat(493873) growth associated protein 43
cow(281777) growth associated protein 43
dog(478572) growth associated protein 43
naked mole-rat(101709889) growth associated protein 43
Goat(100860764) growth associated protein 43
sheep(101103773) growth associated protein 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300525 Anti-GAP43 (Ab-41) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1405847 Anti-GAP43 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
HPA013392 Anti-GAP43 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA015600 Anti-GAP43 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501101 Anti-GAP43, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4300223 Anti-phospho-GAP43 (pSer41) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence pricing
SAB4504413 Anti-phospho-GAP43 (pSer41) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence pricing
G8043 Anti-phospho-Growth Associated Protein-43 (pSer41) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB1402204 Monoclonal Anti-GAP43 antibody produced in mouse clone 3C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
G9264 Monoclonal Anti-Growth Associated Protein-43 antibody produced in mouse clone GAP-7B10, ascites fluid hamster, mouse, snake, human, rat, feline, chicken
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002045 Rosetta Predictions human pricing
NM_017195 Rosetta Predictions rat pricing
NM_008083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153698 predicted 320
2 SASI_Hs01_00153699 predicted 371
3 SASI_Hs01_00153700 predicted 332
4 SASI_Hs01_00153701 predicted 315
5 SASI_Hs01_00153702 predicted 782
6 SASI_Hs01_00153703 predicted 155
7 SASI_Hs01_00153704 predicted 1054
8 SASI_Hs02_00333080 predicted 240
9 SASI_Hs01_00153705 predicted 496
10 SASI_Hs02_00333081 predicted 992
11 SASI_Hs01_00153696 predicted 359
12 SASI_Hs01_00153697 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080369 predicted 607
2 SASI_Rn01_00080370 predicted 460
3 SASI_Rn01_00080371 predicted 664
4 SASI_Rn02_00261548 predicted 651
5 SASI_Rn02_00261549 predicted 434
6 SASI_Rn02_00261550 predicted 600
7 SASI_Rn01_00080372 predicted 617
8 SASI_Rn01_00080373 predicted 414
9 SASI_Rn01_00080375 predicted 662
10 SASI_Rn01_00080376 predicted 530
11 SASI_Rn01_00080374 predicted 616
12 SASI_Rn01_00080377 predicted 617
13 SASI_Rn01_00080378 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139017 predicted 546
2 SASI_Mm01_00139018 predicted 386
3 SASI_Mm02_00313102 predicted 364
4 SASI_Mm01_00139020 predicted 538
5 SASI_Mm01_00139021 predicted 587
6 SASI_Mm01_00139022 predicted 456
7 SASI_Mm01_00139023 predicted 547
8 SASI_Mm01_00139024 predicted 543
9 SASI_Mm01_00139025 predicted 603
10 SASI_Mm01_00139026 predicted 770
11 SASI_Mm01_00139019 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002045
GAP43 MISSION shRNA Bacterial Glycerol Stock
growth associated protein 43
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002045.3-477s21c1
Sequence:CCCGGCTCATAAGGCCGCAACCAAACTCGAGTTTGGTTGCGGCCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002045.3-1302s21c1
Sequence:CCGGGTCAAACAGTGTGGCTTAAACCTCGAGGTTTAAGCCACACTGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-212s1c1
Sequence:CCGGCGTGGACACATAACAAGGAAACTCGAGTTTCCTTGTTATGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-275s1c1
Sequence:CCGGGCTGAAGCTAATAAGAAGGATCTCGAGATCCTTCTTATTAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-513s1c1
Sequence:CCGGCCACTAAAGCTTCCACTGATACTCGAGTATCAGTGGAAGCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-149s1c1
Sequence:CCGGCAAGATGGTATCAAACCAGAACTCGAGTTCTGGTTTGATACCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-718s1c1
Sequence:CCGGTGTAGATGAAACCAAACCTAACTCGAGTTAGGTTTGGTTTCATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002045
GAP43 MISSION shRNA shRNA Plasmid DNA
growth associated protein 43
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002045.3-477s21c1
Sequence:CCCGGCTCATAAGGCCGCAACCAAACTCGAGTTTGGTTGCGGCCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002045.3-1302s21c1
Sequence:CCGGGTCAAACAGTGTGGCTTAAACCTCGAGGTTTAAGCCACACTGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-212s1c1
Sequence:CCGGCGTGGACACATAACAAGGAAACTCGAGTTTCCTTGTTATGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-275s1c1
Sequence:CCGGGCTGAAGCTAATAAGAAGGATCTCGAGATCCTTCTTATTAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-513s1c1
Sequence:CCGGCCACTAAAGCTTCCACTGATACTCGAGTATCAGTGGAAGCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-149s1c1
Sequence:CCGGCAAGATGGTATCAAACCAGAACTCGAGTTCTGGTTTGATACCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-718s1c1
Sequence:CCGGTGTAGATGAAACCAAACCTAACTCGAGTTAGGTTTGGTTTCATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002045
GAP43 MISSION shRNA Lentiviral Transduction Particles
growth associated protein 43
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002045.3-477s21c1
Sequence:CCCGGCTCATAAGGCCGCAACCAAACTCGAGTTTGGTTGCGGCCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002045.3-1302s21c1
Sequence:CCGGGTCAAACAGTGTGGCTTAAACCTCGAGGTTTAAGCCACACTGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-212s1c1
Sequence:CCGGCGTGGACACATAACAAGGAAACTCGAGTTTCCTTGTTATGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-275s1c1
Sequence:CCGGGCTGAAGCTAATAAGAAGGATCTCGAGATCCTTCTTATTAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-513s1c1
Sequence:CCGGCCACTAAAGCTTCCACTGATACTCGAGTATCAGTGGAAGCTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-149s1c1
Sequence:CCGGCAAGATGGTATCAAACCAGAACTCGAGTTCTGGTTTGATACCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002045.2-718s1c1
Sequence:CCGGTGTAGATGAAACCAAACCTAACTCGAGTTAGGTTTGGTTTCATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008083
VALIDATED
GAP43 MISSION shRNA Bacterial Glycerol Stock
growth associated protein 43
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-549s21c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008083.2-1152s21c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-227s21c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-751s21c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008083.2-1152s1c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-227s1c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-751s1c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008083.2-549s1c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-780s1c1
Sequence:CCGGGCCCGACAGGATGAGGGTAAACTCGAGTTTACCCTCATCCTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008083
VALIDATED
GAP43 MISSION shRNA shRNA Plasmid DNA
growth associated protein 43
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-549s21c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008083.2-1152s21c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-227s21c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-751s21c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008083.2-1152s1c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-227s1c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-751s1c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008083.2-549s1c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-780s1c1
Sequence:CCGGGCCCGACAGGATGAGGGTAAACTCGAGTTTACCCTCATCCTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008083
VALIDATED
GAP43 MISSION shRNA Lentiviral Transduction Particles
growth associated protein 43
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-549s21c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008083.2-1152s21c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-227s21c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008083.2-751s21c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008083.2-1152s1c1
Sequence:CCGGGAGTCCACTTTCCTCTCTATTCTCGAGAATAGAGAGGAAAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-227s1c1
Sequence:CCGGGCCGGAAGATAAGGCTCATAACTCGAGTTATGAGCCTTATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-751s1c1
Sequence:CCGGCTGTAGACGAAGCCAAACCTACTCGAGTAGGTTTGGCTTCGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008083.2-549s1c1
Sequence:CCGGGCTGCTAAAGCTACCACTGATCTCGAGATCAGTGGTAGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008083.2-780s1c1
Sequence:CCGGGCCCGACAGGATGAGGGTAAACTCGAGTTTACCCTCATCCTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks