EMAIL THIS PAGE TO A FRIEND

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

74 Gene Product Result for
Synonyms: G3PD GAPD
UniProtKB ID: P04406, E7EUT4, P00354, Q53X65
Gene ID:
Human(2597) Summary: The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The enzyme exists as a tetramer of identical chains. Many pseudogenes similar to this locus are present in the human genome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(14433) glyceraldehyde-3-phosphate dehydrogenase
Rat(24383) glyceraldehyde-3-phosphate dehydrogenase
Zebrafish(317743) glyceraldehyde-3-phosphate dehydrogenase
cow(281181) glyceraldehyde-3-phosphate dehydrogenase
cow(786101) glyceraldehyde-3-phosphate dehydrogenase-like
Horse(100033897) glyceraldehyde-3-phosphate dehydrogenase
domestic cat(493876) glyceraldehyde-3-phosphate dehydrogenase
dog(403755) glyceraldehyde-3-phosphate dehydrogenase
chicken(374193) glyceraldehyde-3-phosphate dehydrogenase
Goat(100860872) glyceraldehyde-3-phosphate dehydrogenase
Domestic Rabbit(100009074) glyceraldehyde-3-phosphate dehydrogenase
sheep(443005) glyceraldehyde-3-phosphate dehydrogenase
naked mole-rat(101703971) glyceraldehyde-3-phosphate dehydrogenase
domestic guinea pig(100135525) glyceraldehyde-3-phosphate dehydrogenase
Gene Class: Apoptosis, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108668 Anti-GAPDH affinity isolated antibody guinea pig, rabbit, sheep, rat, mouse, canine, rat, horse, goat, bovine
western blot pricing
SAB2500451 Anti-GAPDH (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
GW22763 Anti-GAPDH antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB3500247 Anti-GAPDH antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1405848 Anti-GAPDH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2701826 Anti-gapdh antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701825 Anti-gapdh antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2108266 Anti-GAPDH antibody produced in rabbit affinity isolated antibody rat, rabbit, human, horse, pig, guinea pig, mouse
western blot pricing
G9545 Anti-GAPDH antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunoprecipitation, western blot pricing
SAB2100894 Anti-GAPDH antibody produced in rabbit affinity isolated antibody sheep, canine, guinea pig, horse, human, rabbit, rat, mouse, goat
western blot pricing
SAB2103104 Anti-GAPDH antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, rabbit, human, rat, mouse, pig
western blot pricing
SAB4300645 Anti-GAPDH antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
HPA040067 Anti-GAPDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA061280 Anti-GAPDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2500450 Anti-GAPDH, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
PLA0302 Goat anti-GAPDH Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
proximity ligation assay, western blot pricing
G8795 Monoclonal Anti-GAPDH antibody produced in mouse ~1 mg/mL, clone GAPDH-71.1, purified immunoglobulin, buffered aqueous solution rat, chicken, human, turkey, mouse, bovine, canine, mink, monkey, hamster, rabbit
ELISA, immunocytochemistry, microarray, western blot pricing
WH0002597M1 Monoclonal Anti-GAPDH antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91153 Monoclonal Anti-GAPDH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3266, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91152 Monoclonal Anti-GAPDH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3265, purified immunoglobulin New rat, human, mouse
immunohistochemistry, western blot pricing
SAB1403850 Monoclonal Anti-GAPDH, (C-terminal) antibody produced in mouse clone 1G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
G9295 Monoclonal Anti-GAPDH−Peroxidase antibody produced in mouse clone GAPDH-71.1, purified immunoglobulin, buffered aqueous solution turkey, monkey, canine, chicken, human, bovine, rat, mouse, mink, rabbit, hamster
western blot pricing
PLA0125 Rabbit anti-GAPDH Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human, rhesus monkey, turkey, gorilla, rat, pig, chicken, chimpanzee, marmoset
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1476 Human GAPHD ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002046 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
07-2184 Anti-acetyl-GAPDH (Lys160) Antibody 100 µg, This Anti-acetyl-GAPDH (Lys160) antibody is validated for use in western blotting, peptide inhibition assay & IP for the detection of acetyl-GAPDH (Lys160). pricing
AB2302 Anti-GAPDH Antibody 100 µg, Anti-GAPDH Antibody detects level of GAPDH & has been published & validated for use in WB. pricing
ABS16 Anti-GAPDH Antibody 100 µg, Anti-Glyceraldehyde-3-Phosphate Dehydrogenase Antibody is popular affinity purified polyclonal antibody. This antibody is supported by peer reviewed publications and reliably detects Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) is validated for use in WB. pricing
MAB374-AF488 Anti-GAPDH Antibody, clone 6C5, Alexa Fluor® 488 conjugate 100 µL, This Anti-GAPDH Antibody, clone 6C5, Alexa Fluor® 488 conjugate is validated for use in Immunocytochemistry for the detection of GAPDH. pricing
MAB374-AF647 Anti-GAPDH Antibody, clone 6C5, Alexa Fluor® 647 conjugate 100 µL, This Anti-GAPDH Antibody, clone 6C5, Alexa Fluor® 647 conjugate is validated for use in Immunocytochemistry for the detection of GAPDH. pricing
MAB374 Anti-Glyceraldehyde-3-Phosphate Dehydrogenase Antibody, clone 6C5 200 µg, Anti-Glyceraldehyde-3-Phosphate Dehydrogenase Antibody, clone 6C5 is a well published and extensively characterized monoclonal antibody. This purified mAb detects Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) & has been published & validated for use in ELISA, IP, IC, IF, IH & WB. pricing
SF-126 GAPDH; Human, Cyanine 3, RNA Detection Probe | SmartFlare 250 reactions, SmartFlare GAPDH; Human, Cyanine 3 is a RNA Detection probe that targets the GAPDH housekeeping gene. Use SmartFlare housekeeping controls as a proof of concept for your gene expression experiments or as a positive control for gene modulation experiments. pricing
SF-136 GAPDH; Human, Cyanine 5, RNA Detection Probe | SmartFlare 250 reactions, SmartFlare GAPDH; Human, Cyanine 5 is a RNA Detection probe that targets the GAPDH housekeeping gene. Use SmartFlare housekeeping controls as a proof of concept for your gene expression experiments or as a positive control for gene modulation experiments. pricing
FCMAB252F Milli-Mark™ Anti-GAPDH-FITC Antibody, clone 6C5 100 tests, Milli-Mark Anti-GAPDH-FITC Antibody, clone 6C5 is a purified monoclonal antibody labeled with Fluorescein isothiocyanate (FITC). This well characterized mAb specifically detects Glyceraldehyde-3-Phosphate Dehydrogenase and is validated for use in Flow Cytometry. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002046 Rosetta Predictions human pricing
NM_017008 Rosetta Predictions rat pricing
XM_579386 Rosetta Predictions rat pricing
NM_008084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140981 predicted 230
2 SASI_Hs01_00140990 predicted 1063
3 SASI_Hs01_00140982 predicted 830
4 SASI_Hs01_00140983 predicted 286
5 SASI_Hs02_00333082 predicted 815
6 SASI_Hs01_00140985 predicted 602
7 SASI_Hs02_00333083 predicted 120
8 SASI_Hs02_00333084 predicted 172
9 SASI_Hs01_00140984 predicted 624
10 SASI_Hs01_00140987 predicted 859
11 SASI_Hs01_00140988 predicted 498
12 SASI_Hs01_00140989 predicted 744
13 SASI_Hs01_00140986 positive 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261166 predicted 1231
2 SASI_Rn01_00037848 predicted 875
3 SASI_Rn01_00037849 positive 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123540 predicted 1198
2 SASI_Rn01_00123541 predicted 74
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189762 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008084
GAPDH MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde-3-phosphate dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-101s1c1
Sequence:CCGGGCTGCCATTTGCAGTGGCAAACTCGAGTTTGCCACTGCAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-315s1c1
Sequence:CCGGCTGAGTATGTCGTGGAGTCTACTCGAGTAGACTCCACGACATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-648s1c1
Sequence:CCGGCCCAGAACATCATCCCTGCATCTCGAGATGCAGGGATGATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-979s1c1
Sequence:CCGGGTATGACAATGAATACGGCTACTCGAGTAGCCGTATTCATTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-113s1c1
Sequence:CCGGAGTGGCAAAGTGGAGATTGTTCTCGAGAACAATCTCCACTTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008084
GAPDH MISSION shRNA shRNA Plasmid DNA
glyceraldehyde-3-phosphate dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-101s1c1
Sequence:CCGGGCTGCCATTTGCAGTGGCAAACTCGAGTTTGCCACTGCAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-315s1c1
Sequence:CCGGCTGAGTATGTCGTGGAGTCTACTCGAGTAGACTCCACGACATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-648s1c1
Sequence:CCGGCCCAGAACATCATCCCTGCATCTCGAGATGCAGGGATGATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-979s1c1
Sequence:CCGGGTATGACAATGAATACGGCTACTCGAGTAGCCGTATTCATTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-113s1c1
Sequence:CCGGAGTGGCAAAGTGGAGATTGTTCTCGAGAACAATCTCCACTTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008084
GAPDH MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde-3-phosphate dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-101s1c1
Sequence:CCGGGCTGCCATTTGCAGTGGCAAACTCGAGTTTGCCACTGCAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-315s1c1
Sequence:CCGGCTGAGTATGTCGTGGAGTCTACTCGAGTAGACTCCACGACATACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-648s1c1
Sequence:CCGGCCCAGAACATCATCCCTGCATCTCGAGATGCAGGGATGATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-979s1c1
Sequence:CCGGGTATGACAATGAATACGGCTACTCGAGTAGCCGTATTCATTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008084.1-113s1c1
Sequence:CCGGAGTGGCAAAGTGGAGATTGTTCTCGAGAACAATCTCCACTTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002046
GAPDH MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde-3-phosphate dehydrogenase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-157s1c1
Sequence:CCGGGTGGATATTGTTGCCATCAATCTCGAGATTGATGGCAACAATATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-1002s1c1
Sequence:CCGGGCTCATTTCCTGGTATGACAACTCGAGTTGTCATACCAGGAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-912s1c1
Sequence:CCGGCCAGGTGGTCTCCTCTGACTTCTCGAGAAGTCAGAGGAGACCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-649s1c1
Sequence:CCGGTCCGGGAAACTGTGGCGTGATCTCGAGATCACGCCACAGTTTCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-833s21c1
Sequence:CCGGACCTGACCTGCCGTCTAGAAACTCGAGTTTCTAGACGGCAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-243s21c1
Sequence:CCGGCCAATATGATTCCACCCATGGCTCGAGCCATGGGTGGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002046
GAPDH MISSION shRNA shRNA Plasmid DNA
glyceraldehyde-3-phosphate dehydrogenase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-157s1c1
Sequence:CCGGGTGGATATTGTTGCCATCAATCTCGAGATTGATGGCAACAATATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-1002s1c1
Sequence:CCGGGCTCATTTCCTGGTATGACAACTCGAGTTGTCATACCAGGAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-912s1c1
Sequence:CCGGCCAGGTGGTCTCCTCTGACTTCTCGAGAAGTCAGAGGAGACCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-649s1c1
Sequence:CCGGTCCGGGAAACTGTGGCGTGATCTCGAGATCACGCCACAGTTTCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-833s21c1
Sequence:CCGGACCTGACCTGCCGTCTAGAAACTCGAGTTTCTAGACGGCAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-243s21c1
Sequence:CCGGCCAATATGATTCCACCCATGGCTCGAGCCATGGGTGGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002046
GAPDH MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde-3-phosphate dehydrogenase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-157s1c1
Sequence:CCGGGTGGATATTGTTGCCATCAATCTCGAGATTGATGGCAACAATATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-1002s1c1
Sequence:CCGGGCTCATTTCCTGGTATGACAACTCGAGTTGTCATACCAGGAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-912s1c1
Sequence:CCGGCCAGGTGGTCTCCTCTGACTTCTCGAGAAGTCAGAGGAGACCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002046.2-649s1c1
Sequence:CCGGTCCGGGAAACTGTGGCGTGATCTCGAGATCACGCCACAGTTTCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-833s21c1
Sequence:CCGGACCTGACCTGCCGTCTAGAAACTCGAGTTTCTAGACGGCAGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002046.3-243s21c1
Sequence:CCGGCCAATATGATTCCACCCATGGCTCGAGCCATGGGTGGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks