EMAIL THIS PAGE TO A FRIEND

GAPDHP24

glyceraldehyde 3 phosphate dehydrogenase pseudogene 24

Species: Human GAPDHP24(391162)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372812
GAPDHP24 MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde 3 phosphate dehydrogenase pseudogene 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-346s1c1
Sequence:CCGGCCTGGTATTACAGTGCAGTTACTCGAGTAACTGCACTGTAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-252s1c1
Sequence:CCGGCCACGTTGTCTCTTACTTTAACTCGAGTTAAAGTAAGAGACAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-430s1c1
Sequence:CCGGCCATCAACACAAGCAAGAGCACTCGAGTGCTCTTGCTTGTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-124s1c1
Sequence:CCGGACTGCCAACATGTTGGTACGACTCGAGTCGTACCAACATGTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-279s1c1
Sequence:CCGGCACCCATTCTTCCACCTTGATCTCGAGATCAAGGTGGAAGAATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372812
GAPDHP24 MISSION shRNA shRNA Plasmid DNA
glyceraldehyde 3 phosphate dehydrogenase pseudogene 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-346s1c1
Sequence:CCGGCCTGGTATTACAGTGCAGTTACTCGAGTAACTGCACTGTAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-252s1c1
Sequence:CCGGCCACGTTGTCTCTTACTTTAACTCGAGTTAAAGTAAGAGACAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-430s1c1
Sequence:CCGGCCATCAACACAAGCAAGAGCACTCGAGTGCTCTTGCTTGTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-124s1c1
Sequence:CCGGACTGCCAACATGTTGGTACGACTCGAGTCGTACCAACATGTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-279s1c1
Sequence:CCGGCACCCATTCTTCCACCTTGATCTCGAGATCAAGGTGGAAGAATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372812
GAPDHP24 MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde 3 phosphate dehydrogenase pseudogene 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-346s1c1
Sequence:CCGGCCTGGTATTACAGTGCAGTTACTCGAGTAACTGCACTGTAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-252s1c1
Sequence:CCGGCCACGTTGTCTCTTACTTTAACTCGAGTTAAAGTAAGAGACAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-430s1c1
Sequence:CCGGCCATCAACACAAGCAAGAGCACTCGAGTGCTCTTGCTTGTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-124s1c1
Sequence:CCGGACTGCCAACATGTTGGTACGACTCGAGTCGTACCAACATGTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372812.1-279s1c1
Sequence:CCGGCACCCATTCTTCCACCTTGATCTCGAGATCAAGGTGGAAGAATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks