EMAIL THIS PAGE TO A FRIEND

GAPDHP27

glyceraldehyde 3 phosphate dehydrogenase pseudogene 27

Gene Product Result for
Species: Human GAPDHP27(401960)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377597
GAPDHP27 MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde 3 phosphate dehydrogenase pseudogene 27
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-288s1c1
Sequence:CCGGCCATGTACCTACCACCATCATCTCGAGATGATGGTGGTAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-189s1c1
Sequence:CCGGCAGGGCTCAAAGGAACATCATCTCGAGATGATGTTCCTTTGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-278s1c1
Sequence:CCGGGCATGGCATTCCATGTACCTACTCGAGTAGGTACATGGAATGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-85s1c1
Sequence:CCGGGACAACTCTGATATGGTGGAACTCGAGTTCCACCATATCAGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-405s1c1
Sequence:CCGGCATCCTTTGCTACACTGAGAACTCGAGTTCTCAGTGTAGCAAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377597
GAPDHP27 MISSION shRNA shRNA Plasmid DNA
glyceraldehyde 3 phosphate dehydrogenase pseudogene 27
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-288s1c1
Sequence:CCGGCCATGTACCTACCACCATCATCTCGAGATGATGGTGGTAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-189s1c1
Sequence:CCGGCAGGGCTCAAAGGAACATCATCTCGAGATGATGTTCCTTTGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-278s1c1
Sequence:CCGGGCATGGCATTCCATGTACCTACTCGAGTAGGTACATGGAATGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-85s1c1
Sequence:CCGGGACAACTCTGATATGGTGGAACTCGAGTTCCACCATATCAGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-405s1c1
Sequence:CCGGCATCCTTTGCTACACTGAGAACTCGAGTTCTCAGTGTAGCAAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377597
GAPDHP27 MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde 3 phosphate dehydrogenase pseudogene 27
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-288s1c1
Sequence:CCGGCCATGTACCTACCACCATCATCTCGAGATGATGGTGGTAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-189s1c1
Sequence:CCGGCAGGGCTCAAAGGAACATCATCTCGAGATGATGTTCCTTTGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-278s1c1
Sequence:CCGGGCATGGCATTCCATGTACCTACTCGAGTAGGTACATGGAATGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-85s1c1
Sequence:CCGGGACAACTCTGATATGGTGGAACTCGAGTTCCACCATATCAGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377597.1-405s1c1
Sequence:CCGGCATCCTTTGCTACACTGAGAACTCGAGTTCTCAGTGTAGCAAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks