EMAIL THIS PAGE TO A FRIEND

GAPDHP72

glyceraldehyde-3-phosphate dehydrogenase pseudogene 72

30 Gene Product Result for
Synonyms: GAPDHL18 GAPDL18
Species: Human GAPDHP72(346085)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_294070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016419 Rosetta Predictions human pricing
XR_019389 Rosetta Predictions human pricing
XR_036928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00490891 predicted 865
2 SASI_Hs02_00490892 predicted 367
3 SASI_Hs02_00490893 predicted 366
4 SASI_Hs02_00490894 predicted 374
5 SASI_Hs02_00490895 predicted 846
6 SASI_Hs02_00490896 predicted 296
7 SASI_Hs02_00490897 predicted 981
8 SASI_Hs02_00490898 predicted 383
9 SASI_Hs02_00490899 predicted 747
10 SASI_Hs02_00490900 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_019389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00497825 predicted 865
2 SASI_Hs02_00497826 predicted 371
3 SASI_Hs02_00497827 predicted 370
4 SASI_Hs02_00497828 predicted 371
5 SASI_Hs02_00497829 predicted 849
6 SASI_Hs02_00497830 predicted 292
7 SASI_Hs02_00497831 predicted 983
8 SASI_Hs02_00497832 predicted 383
9 SASI_Hs02_00497833 predicted 748
10 SASI_Hs02_00497834 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_036928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00499109 predicted 857
2 SASI_Hs02_00499110 predicted 369
3 SASI_Hs02_00499111 predicted 371
4 SASI_Hs02_00499112 predicted 366
5 SASI_Hs02_00499113 predicted 847
6 SASI_Hs02_00499114 predicted 291
7 SASI_Hs02_00499115 predicted 980
8 SASI_Hs02_00499116 predicted 384
9 SASI_Hs02_00499117 predicted 748
10 SASI_Hs02_00499118 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294070
GAPDHP72 MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde-3-phosphate dehydrogenase pseudogene 72
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-38s1c1
Sequence:CCGGGACTGGAGAAGCATGGAAGAACTCGAGTTCTTCCATGCTTCTCCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1128s1c1
Sequence:CCGGCGTGTTCATAATGGGTGTGAACTCGAGTTCACACCCATTATGAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-168s1c1
Sequence:CCGGGCATTATCTAATCAGCTCACTCTCGAGAGTGAGCTGATTAGATAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-454s1c1
Sequence:CCGGACAGGCACACTATCAAGGCATCTCGAGATGCCTTGATAGTGTGCCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1230s1c1
Sequence:CCGGCCTCCATGACAACTTTGGTATCTCGAGATACCAAAGTTGTCATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294070
GAPDHP72 MISSION shRNA shRNA Plasmid DNA
glyceraldehyde-3-phosphate dehydrogenase pseudogene 72
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-38s1c1
Sequence:CCGGGACTGGAGAAGCATGGAAGAACTCGAGTTCTTCCATGCTTCTCCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1128s1c1
Sequence:CCGGCGTGTTCATAATGGGTGTGAACTCGAGTTCACACCCATTATGAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-168s1c1
Sequence:CCGGGCATTATCTAATCAGCTCACTCTCGAGAGTGAGCTGATTAGATAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-454s1c1
Sequence:CCGGACAGGCACACTATCAAGGCATCTCGAGATGCCTTGATAGTGTGCCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1230s1c1
Sequence:CCGGCCTCCATGACAACTTTGGTATCTCGAGATACCAAAGTTGTCATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294070
GAPDHP72 MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde-3-phosphate dehydrogenase pseudogene 72
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-38s1c1
Sequence:CCGGGACTGGAGAAGCATGGAAGAACTCGAGTTCTTCCATGCTTCTCCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1128s1c1
Sequence:CCGGCGTGTTCATAATGGGTGTGAACTCGAGTTCACACCCATTATGAACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-168s1c1
Sequence:CCGGGCATTATCTAATCAGCTCACTCTCGAGAGTGAGCTGATTAGATAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-454s1c1
Sequence:CCGGACAGGCACACTATCAAGGCATCTCGAGATGCCTTGATAGTGTGCCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294070.3-1230s1c1
Sequence:CCGGCCTCCATGACAACTTTGGTATCTCGAGATACCAAAGTTGTCATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)