EMAIL THIS PAGE TO A FRIEND

GAPDHS

glyceraldehyde-3-phosphate dehydrogenase, spermatogenic

52 Gene Product Result for
Synonyms: GAPD2 GAPDH-2 GAPDS HSD-35
UniProtKB ID: O14556, B2RC82, O60823, Q6JTT9, Q9HCU6
Gene ID:
Human(26330) Summary: This gene encodes a protein belonging to the glyceraldehyde-3-phosphate dehydrogenase family of enzymes that play an important role in carbohydrate metabolism. Like its somatic cell counterpart, this sperm-specific enzyme functions in a nicotinamide adenine dinucleotide-dependent manner to remove hydrogen and add phosphate to glyceraldehyde 3-phosphate to form 1,3-diphosphoglycerate. During spermiogenesis, this enzyme may play an important role in regulating the switch between different energy-producing pathways, and it is required for sperm motility and male fertility. [provided by RefSeq, Jul 2008]
Mouse(14447) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Rat(66020) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Zebrafish(406367) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
dog(476483) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
domestic cat(101099515) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
cow(532231) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Horse(100051032) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
sheep(101103587) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Domestic Rabbit(100352213) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
domestic guinea pig(100723162) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
naked mole-rat(101714331) glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051401 MISSION® esiRNA esiRNA human GAPDHS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014364 Rosetta Predictions human pricing
NM_023964 Rosetta Predictions rat pricing
NM_008085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175614 predicted 1099
2 SASI_Hs01_00175615 predicted 454
3 SASI_Hs02_00345511 predicted 548
4 SASI_Hs01_00175616 predicted 712
5 SASI_Hs02_00345512 predicted 848
6 SASI_Hs02_00345513 predicted 247
7 SASI_Hs02_00345514 predicted 718
8 SASI_Hs01_00175619 predicted 623
9 SASI_Hs01_00175620 predicted 663
10 SASI_Hs01_00175623 predicted 484
11 SASI_Hs01_00175617 predicted 921
12 SASI_Hs01_00175618 predicted 1192
13 SASI_Hs01_00175621 predicted 1147
14 SASI_Hs01_00175622 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073405 predicted 850
2 SASI_Rn01_00073406 predicted 847
3 SASI_Rn01_00073407 predicted 512
4 SASI_Rn01_00073408 predicted 505
5 SASI_Rn01_00073409 predicted 580
6 SASI_Rn01_00073410 predicted 715
7 SASI_Rn01_00073411 predicted 495
8 SASI_Rn01_00073412 predicted 698
9 SASI_Rn01_00073413 predicted 576
10 SASI_Rn01_00073414 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045934 predicted 728
2 SASI_Mm01_00045935 predicted 966
3 SASI_Mm01_00045936 predicted 617
4 SASI_Mm01_00045937 predicted 859
5 SASI_Mm01_00045938 predicted 712
6 SASI_Mm01_00045939 predicted 699
7 SASI_Mm01_00045940 predicted 557
8 SASI_Mm01_00045941 predicted 510
9 SASI_Mm01_00045943 predicted 530
10 SASI_Mm02_00313103 predicted 1070
11 SASI_Mm01_00045942 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014364
GAPDHS MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-396s1c1
Sequence:CCGGCCCGGAATACATGGTGTACATCTCGAGATGTACACCATGTATTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-154s1c1
Sequence:CCGGCCTGAGCCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1155s1c1
Sequence:CCGGCTCGTCCATCTTCGATGCTAACTCGAGTTAGCATCGAAGATGGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-373s1c1
Sequence:CCGGGCTGTGAATGATCCATTCATTCTCGAGAATGAATGGATCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1216s1c1
Sequence:CCGGTCATGGTACGACAACGAATATCTCGAGATATTCGTTGTCGTACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-1181s21c1
Sequence:CCGGTACGGACTTCCTCGGTGATACCTCGAGGTATCACCGAGGAAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-249s21c1
Sequence:CCGGACACCAGTCAGGGAGGAAATACTCGAGTATTTCCTCCCTGACTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-396s21c1
Sequence:CCGGTGCATGGAGAAGGGTGTTAAGCTCGAGCTTAACACCCTTCTCCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-340s21c1
Sequence:CCGGAGCTGACTGTGGGCATCAATGCTCGAGCATTGATGCCCACAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014364
GAPDHS MISSION shRNA shRNA Plasmid DNA
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-396s1c1
Sequence:CCGGCCCGGAATACATGGTGTACATCTCGAGATGTACACCATGTATTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-154s1c1
Sequence:CCGGCCTGAGCCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1155s1c1
Sequence:CCGGCTCGTCCATCTTCGATGCTAACTCGAGTTAGCATCGAAGATGGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-373s1c1
Sequence:CCGGGCTGTGAATGATCCATTCATTCTCGAGAATGAATGGATCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1216s1c1
Sequence:CCGGTCATGGTACGACAACGAATATCTCGAGATATTCGTTGTCGTACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-1181s21c1
Sequence:CCGGTACGGACTTCCTCGGTGATACCTCGAGGTATCACCGAGGAAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-249s21c1
Sequence:CCGGACACCAGTCAGGGAGGAAATACTCGAGTATTTCCTCCCTGACTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-396s21c1
Sequence:CCGGTGCATGGAGAAGGGTGTTAAGCTCGAGCTTAACACCCTTCTCCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-340s21c1
Sequence:CCGGAGCTGACTGTGGGCATCAATGCTCGAGCATTGATGCCCACAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014364
GAPDHS MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-396s1c1
Sequence:CCGGCCCGGAATACATGGTGTACATCTCGAGATGTACACCATGTATTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-154s1c1
Sequence:CCGGCCTGAGCCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1155s1c1
Sequence:CCGGCTCGTCCATCTTCGATGCTAACTCGAGTTAGCATCGAAGATGGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-373s1c1
Sequence:CCGGGCTGTGAATGATCCATTCATTCTCGAGAATGAATGGATCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014364.3-1216s1c1
Sequence:CCGGTCATGGTACGACAACGAATATCTCGAGATATTCGTTGTCGTACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-1181s21c1
Sequence:CCGGTACGGACTTCCTCGGTGATACCTCGAGGTATCACCGAGGAAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-249s21c1
Sequence:CCGGACACCAGTCAGGGAGGAAATACTCGAGTATTTCCTCCCTGACTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-396s21c1
Sequence:CCGGTGCATGGAGAAGGGTGTTAAGCTCGAGCTTAACACCCTTCTCCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014364.4-340s21c1
Sequence:CCGGAGCTGACTGTGGGCATCAATGCTCGAGCATTGATGCCCACAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008085
GAPDHS MISSION shRNA Bacterial Glycerol Stock
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-406s1c1
Sequence:CCGGGACCCATTCATTGATCCAGAACTCGAGTTCTGGATCAATGAATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-459s1c1
Sequence:CCGGACATGGTAGATACAAAGGAAACTCGAGTTTCCTTTGTATCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-535s1c1
Sequence:CCGGCAGTGCAAAGACCCTAAAGAACTCGAGTTCTTTAGGGTCTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-984s1c1
Sequence:CCGGGAAGCTAACAGGAATGGCATTCTCGAGAATGCCATTCCTGTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-733s1c1
Sequence:CCGGTCTATGACCATTGTCAGCAATCTCGAGATTGCTGACAATGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008085
GAPDHS MISSION shRNA shRNA Plasmid DNA
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-406s1c1
Sequence:CCGGGACCCATTCATTGATCCAGAACTCGAGTTCTGGATCAATGAATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-459s1c1
Sequence:CCGGACATGGTAGATACAAAGGAAACTCGAGTTTCCTTTGTATCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-535s1c1
Sequence:CCGGCAGTGCAAAGACCCTAAAGAACTCGAGTTCTTTAGGGTCTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-984s1c1
Sequence:CCGGGAAGCTAACAGGAATGGCATTCTCGAGAATGCCATTCCTGTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-733s1c1
Sequence:CCGGTCTATGACCATTGTCAGCAATCTCGAGATTGCTGACAATGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008085
GAPDHS MISSION shRNA Lentiviral Transduction Particles
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-406s1c1
Sequence:CCGGGACCCATTCATTGATCCAGAACTCGAGTTCTGGATCAATGAATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-459s1c1
Sequence:CCGGACATGGTAGATACAAAGGAAACTCGAGTTTCCTTTGTATCTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-535s1c1
Sequence:CCGGCAGTGCAAAGACCCTAAAGAACTCGAGTTCTTTAGGGTCTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-984s1c1
Sequence:CCGGGAAGCTAACAGGAATGGCATTCTCGAGAATGCCATTCCTGTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008085.1-733s1c1
Sequence:CCGGTCTATGACCATTGTCAGCAATCTCGAGATTGCTGACAATGGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks